Incidental Mutation 'R5354:Pcdhb13'
ID424010
Institutional Source Beutler Lab
Gene Symbol Pcdhb13
Ensembl Gene ENSMUSG00000047307
Gene Nameprotocadherin beta 13
SynonymsPcdhbM, Pcdbh6
MMRRC Submission 042933-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5354 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37442500-37446209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37444791 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 741 (G741C)
Ref Sequence ENSEMBL: ENSMUSP00000061087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000052387
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056915
AA Change: G741C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307
AA Change: G741C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.8668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. Unlike the alpha and gamma clusters, the transcripts from these genes do not share common 3' exons. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell neural connections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A G 16: 14,618,671 K196R probably benign Het
Ablim1 T C 19: 57,130,923 E243G probably benign Het
Acat1 T A 9: 53,589,183 E271V possibly damaging Het
Aco1 T C 4: 40,180,290 probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Agbl3 T A 6: 34,814,752 H596Q probably benign Het
Anxa7 A G 14: 20,464,909 L177P possibly damaging Het
Atp11a A T 8: 12,806,753 N48I probably damaging Het
Bcas1 T A 2: 170,349,396 N492I possibly damaging Het
Bclaf1 A G 10: 20,333,532 Y498C probably damaging Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Ccdc170 G A 10: 4,534,188 C338Y probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Ckap2 A C 8: 22,177,565 N93K probably damaging Het
Clca3a1 A T 3: 144,737,005 S759R possibly damaging Het
Coro1c A T 5: 113,846,165 I347N possibly damaging Het
Cpox A G 16: 58,670,842 T139A probably damaging Het
Cyp4a12b C A 4: 115,433,464 probably null Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dhx38 A G 8: 109,555,746 V683A probably damaging Het
Dnah12 G A 14: 26,774,342 probably null Het
Dnajb7 T C 15: 81,408,007 E43G probably damaging Het
Dsc1 A T 18: 20,087,575 V714E probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Egfem1 T C 3: 29,082,212 probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmo1 T C 1: 162,830,145 T476A probably benign Het
Gm10237 T C 16: 35,920,729 noncoding transcript Het
Gm14496 A G 2: 182,000,809 S758G probably damaging Het
Gpat2 T A 2: 127,428,723 L97Q probably damaging Het
Gpr162 T C 6: 124,859,637 D357G probably benign Het
Hax1 A T 3: 89,997,955 D34E probably damaging Het
Hmgcr C T 13: 96,654,896 V97M probably benign Het
Hsd3b2 T C 3: 98,712,315 T105A probably benign Het
Ints1 A G 5: 139,766,428 probably null Het
Islr T C 9: 58,157,612 E204G probably damaging Het
Lrrc36 A G 8: 105,425,364 N60D probably damaging Het
Maf1 T C 15: 76,353,130 probably benign Het
Mrgprb4 T A 7: 48,198,329 R284W probably benign Het
Myh4 A T 11: 67,255,725 N1508I possibly damaging Het
Nufip2 A G 11: 77,686,277 H17R unknown Het
Oasl1 A T 5: 114,936,996 I372L probably damaging Het
Olfr290 T A 7: 84,916,149 Y123* probably null Het
Olfr414 T C 1: 174,430,686 L86P probably damaging Het
Pald1 A T 10: 61,348,661 Y226N probably damaging Het
Pcdhga10 A G 18: 37,748,206 D340G probably damaging Het
Pclo C A 5: 14,678,808 probably benign Het
Pcsk4 G T 10: 80,323,689 N416K probably damaging Het
Pde10a C A 17: 8,961,980 R398S probably damaging Het
Plin1 T A 7: 79,725,721 T227S possibly damaging Het
Pnpt1 A G 11: 29,154,166 D542G probably damaging Het
Ppp4r3b T A 11: 29,211,646 D673E probably benign Het
Prr18 C A 17: 8,341,060 P16Q probably damaging Het
Psmc3 T A 2: 91,059,353 Y440N probably damaging Het
Rassf5 T C 1: 131,180,648 I232V probably benign Het
Rims1 T A 1: 22,538,511 D218V probably damaging Het
Skint10 T C 4: 112,711,593 N309S possibly damaging Het
Slc6a1 T C 6: 114,302,623 M121T possibly damaging Het
Slit3 A G 11: 35,675,913 D1004G probably damaging Het
Snap91 C T 9: 86,835,124 V215I possibly damaging Het
Son T C 16: 91,655,739 L458S probably damaging Het
St18 C T 1: 6,844,171 A782V probably damaging Het
Synpo A G 18: 60,602,231 probably null Het
Thbs3 A G 3: 89,221,377 D458G probably damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Trp63 A G 16: 25,684,355 probably null Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r27 C A 6: 58,215,596 R141L probably benign Het
Wnk1 T C 6: 119,968,523 I699V probably benign Het
Xkr6 A G 14: 63,818,904 D88G possibly damaging Het
Zan A G 5: 137,380,788 probably benign Het
Zbtb7b T C 3: 89,379,606 probably benign Het
Zfp618 A T 4: 63,080,028 D33V probably damaging Het
Other mutations in Pcdhb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Pcdhb13 APN 18 37443721 missense possibly damaging 0.56
IGL00718:Pcdhb13 APN 18 37444821 missense possibly damaging 0.91
IGL01143:Pcdhb13 APN 18 37442637 missense probably benign 0.01
IGL01816:Pcdhb13 APN 18 37442975 missense probably benign 0.00
IGL01916:Pcdhb13 APN 18 37443861 missense possibly damaging 0.64
IGL02063:Pcdhb13 APN 18 37444229 missense probably damaging 1.00
IGL02153:Pcdhb13 APN 18 37443685 missense probably damaging 1.00
IGL02332:Pcdhb13 APN 18 37443582 missense probably benign 0.32
IGL02407:Pcdhb13 APN 18 37443075 missense probably damaging 1.00
IGL02423:Pcdhb13 APN 18 37444339 missense possibly damaging 0.95
IGL02514:Pcdhb13 APN 18 37442991 missense possibly damaging 0.80
IGL03025:Pcdhb13 APN 18 37442764 missense probably damaging 1.00
IGL03227:Pcdhb13 APN 18 37443658 missense probably damaging 0.98
IGL03233:Pcdhb13 APN 18 37444265 missense probably damaging 0.96
IGL03239:Pcdhb13 APN 18 37442835 missense probably damaging 0.97
R0046:Pcdhb13 UTSW 18 37444257 missense probably benign
R0172:Pcdhb13 UTSW 18 37442937 missense probably benign 0.00
R0201:Pcdhb13 UTSW 18 37442581 missense probably benign
R0594:Pcdhb13 UTSW 18 37443931 missense probably damaging 1.00
R1235:Pcdhb13 UTSW 18 37444959 makesense probably null
R1292:Pcdhb13 UTSW 18 37443832 missense probably benign 0.43
R1481:Pcdhb13 UTSW 18 37442836 missense probably damaging 1.00
R1991:Pcdhb13 UTSW 18 37443859 missense possibly damaging 0.80
R2058:Pcdhb13 UTSW 18 37444567 missense possibly damaging 0.95
R3508:Pcdhb13 UTSW 18 37443151 missense probably damaging 0.99
R3713:Pcdhb13 UTSW 18 37443733 missense probably damaging 1.00
R4125:Pcdhb13 UTSW 18 37443820 missense probably damaging 1.00
R4741:Pcdhb13 UTSW 18 37443518 missense probably benign 0.01
R4747:Pcdhb13 UTSW 18 37444815 missense probably damaging 0.99
R4957:Pcdhb13 UTSW 18 37444784 missense possibly damaging 0.95
R4973:Pcdhb13 UTSW 18 37443184 missense probably benign 0.20
R5364:Pcdhb13 UTSW 18 37443508 missense probably damaging 1.00
R5544:Pcdhb13 UTSW 18 37443520 missense possibly damaging 0.92
R5897:Pcdhb13 UTSW 18 37443211 missense probably benign 0.42
R6174:Pcdhb13 UTSW 18 37443421 missense possibly damaging 0.84
R6702:Pcdhb13 UTSW 18 37444775 missense probably benign 0.42
R6765:Pcdhb13 UTSW 18 37443610 missense probably damaging 1.00
R6960:Pcdhb13 UTSW 18 37443456 missense probably benign 0.45
R7144:Pcdhb13 UTSW 18 37443256 missense probably damaging 1.00
R7225:Pcdhb13 UTSW 18 37444437 missense possibly damaging 0.91
R7239:Pcdhb13 UTSW 18 37444644 missense probably damaging 0.99
R7437:Pcdhb13 UTSW 18 37444675 missense probably damaging 1.00
R7812:Pcdhb13 UTSW 18 37442592 missense probably benign 0.00
R7964:Pcdhb13 UTSW 18 37444818 missense possibly damaging 0.62
R8334:Pcdhb13 UTSW 18 37444800 missense probably damaging 1.00
R8463:Pcdhb13 UTSW 18 37443234 missense possibly damaging 0.94
R8476:Pcdhb13 UTSW 18 37444084 missense probably damaging 1.00
R8501:Pcdhb13 UTSW 18 37444440 missense probably damaging 1.00
X0023:Pcdhb13 UTSW 18 37443013 missense probably damaging 1.00
X0028:Pcdhb13 UTSW 18 37444642 missense possibly damaging 0.91
Z1176:Pcdhb13 UTSW 18 37443235 nonsense probably null
Z1177:Pcdhb13 UTSW 18 37442580 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCGCTCACGTTATACCTGG -3'
(R):5'- CATCGATAGCGTGCAGATATAGG -3'

Sequencing Primer
(F):5'- GCGCTCACGTTATACCTGGTTATTG -3'
(R):5'- ATAGCGTGCAGATATAGGTTAAAAG -3'
Posted On2016-08-04