Mutagenetix > Incidental Mutations

Incidental Mutation 'R5354:Ablim1'

424014

Institutional Source

Beutler Lab

Gene Symbol

Ablim1

Ensembl Gene

ENSMUSG00000025085

Gene Name

actin-binding LIM protein 1

Synonyms

2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1

MMRRC Submission

042933-MU

Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene?

Possibly non essential (E-score: 0.358) question?

Stock #

R5354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57032733-57314919 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57130923 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 243 (E243G)

Ref Sequence

ENSEMBL: ENSMUSP00000107149 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000111524] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]

Predicted Effect

probably benign
Transcript: ENSMUST00000079360

SMART Domains

Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
LIM	98	149	1.14e-9	SMART
LIM	157	209	1.37e-12	SMART
LIM	225	276	1.12e-17	SMART
LIM	284	336	5.87e-12	SMART
Pfam:AbLIM_anchor	393	825	1.9e-139	PFAM
VHP	826	861	1.22e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099294

SMART Domains

Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
LIM	22	73	1.14e-9	SMART
LIM	81	133	1.37e-12	SMART
LIM	149	200	1.12e-17	SMART
LIM	208	260	5.87e-12	SMART
low complexity region	284	293	N/A	INTRINSIC
coiled coil region	467	491	N/A	INTRINSIC
low complexity region	516	531	N/A	INTRINSIC
VHP	619	654	1.22e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111524
AA Change: E243G

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107149
Gene: ENSMUSG00000025085
AA Change: E243G

Domain	Start	End	E-Value	Type
LIM	21	72	1.14e-9	SMART
LIM	80	132	1.37e-12	SMART
LIM	148	199	1.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111544

SMART Domains

Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
LIM	22	73	1.14e-9	SMART
LIM	81	133	1.37e-12	SMART
LIM	149	200	1.12e-17	SMART
LIM	208	260	5.87e-12	SMART
low complexity region	284	293	N/A	INTRINSIC
low complexity region	422	427	N/A	INTRINSIC
coiled coil region	481	505	N/A	INTRINSIC
low complexity region	530	545	N/A	INTRINSIC
VHP	633	668	1.22e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111546

SMART Domains

Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
LIM	22	73	5.7e-12	SMART
LIM	81	133	6.6e-15	SMART
LIM	149	200	5.4e-20	SMART
LIM	208	260	2.8e-14	SMART
low complexity region	284	293	N/A	INTRINSIC
coiled coil region	514	538	N/A	INTRINSIC
low complexity region	563	578	N/A	INTRINSIC
VHP	666	700	1.2e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111550

SMART Domains

Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
LIM	22	73	1.14e-9	SMART
LIM	81	133	1.37e-12	SMART
LIM	149	200	1.12e-17	SMART
LIM	208	260	5.87e-12	SMART
low complexity region	312	321	N/A	INTRINSIC
coiled coil region	495	519	N/A	INTRINSIC
low complexity region	544	559	N/A	INTRINSIC
VHP	647	682	1.22e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111555

SMART Domains

Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
LIM	98	149	1.14e-9	SMART
LIM	157	209	1.37e-12	SMART
LIM	225	276	1.12e-17	SMART
LIM	284	336	5.87e-12	SMART
low complexity region	360	369	N/A	INTRINSIC
coiled coil region	590	614	N/A	INTRINSIC
low complexity region	639	654	N/A	INTRINSIC
VHP	742	777	1.22e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111558

SMART Domains

Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
LIM	35	86	1.14e-9	SMART
LIM	94	146	1.37e-12	SMART
LIM	162	213	1.12e-17	SMART
LIM	221	273	5.87e-12	SMART
low complexity region	325	334	N/A	INTRINSIC
low complexity region	498	503	N/A	INTRINSIC
coiled coil region	557	581	N/A	INTRINSIC
low complexity region	606	621	N/A	INTRINSIC
VHP	709	744	1.22e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111559

SMART Domains

Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085

Domain	Start	End	E-Value	Type
LIM	35	86	1.14e-9	SMART
LIM	94	146	1.37e-12	SMART
LIM	162	213	1.12e-17	SMART
LIM	221	273	5.87e-12	SMART
low complexity region	297	306	N/A	INTRINSIC
coiled coil region	527	551	N/A	INTRINSIC
low complexity region	576	591	N/A	INTRINSIC
VHP	679	714	1.22e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128212

Predicted Effect

unknown
Transcript: ENSMUST00000133369
AA Change: E266G

SMART Domains

Protein: ENSMUSP00000117798
Gene: ENSMUSG00000025085
AA Change: E266G

Domain	Start	End	E-Value	Type
LIM	45	96	1.14e-9	SMART
LIM	104	156	1.37e-12	SMART
LIM	172	223	1.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134430

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133782

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156316

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	G	16: 14,618,671	K196R	probably benign	Het
Acat1	T	A	9: 53,589,183	E271V	possibly damaging	Het
Aco1	T	C	4: 40,180,290		probably null	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Agbl3	T	A	6: 34,814,752	H596Q	probably benign	Het
Anxa7	A	G	14: 20,464,909	L177P	possibly damaging	Het
Atp11a	A	T	8: 12,806,753	N48I	probably damaging	Het
Bcas1	T	A	2: 170,349,396	N492I	possibly damaging	Het
Bclaf1	A	G	10: 20,333,532	Y498C	probably damaging	Het
Bod1l	A	C	5: 41,831,537	V409G	probably damaging	Het
Ccdc170	G	A	10: 4,534,188	C338Y	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Ckap2	A	C	8: 22,177,565	N93K	probably damaging	Het
Clca3a1	A	T	3: 144,737,005	S759R	possibly damaging	Het
Coro1c	A	T	5: 113,846,165	I347N	possibly damaging	Het
Cpox	A	G	16: 58,670,842	T139A	probably damaging	Het
Cyp4a12b	C	A	4: 115,433,464		probably null	Het
Dctn1	T	G	6: 83,183,126	V116G	possibly damaging	Het
Dhx38	A	G	8: 109,555,746	V683A	probably damaging	Het
Dnah12	G	A	14: 26,774,342		probably null	Het
Dnajb7	T	C	15: 81,408,007	E43G	probably damaging	Het
Dsc1	A	T	18: 20,087,575	V714E	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Egfem1	T	C	3: 29,082,212		probably null	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fmo1	T	C	1: 162,830,145	T476A	probably benign	Het
Gm10237	T	C	16: 35,920,729		noncoding transcript	Het
Gm14496	A	G	2: 182,000,809	S758G	probably damaging	Het
Gpat2	T	A	2: 127,428,723	L97Q	probably damaging	Het
Gpr162	T	C	6: 124,859,637	D357G	probably benign	Het
Hax1	A	T	3: 89,997,955	D34E	probably damaging	Het
Hmgcr	C	T	13: 96,654,896	V97M	probably benign	Het
Hsd3b2	T	C	3: 98,712,315	T105A	probably benign	Het
Ints1	A	G	5: 139,766,428		probably null	Het
Islr	T	C	9: 58,157,612	E204G	probably damaging	Het
Lrrc36	A	G	8: 105,425,364	N60D	probably damaging	Het
Maf1	T	C	15: 76,353,130		probably benign	Het
Mrgprb4	T	A	7: 48,198,329	R284W	probably benign	Het
Myh4	A	T	11: 67,255,725	N1508I	possibly damaging	Het
Nufip2	A	G	11: 77,686,277	H17R	unknown	Het
Oasl1	A	T	5: 114,936,996	I372L	probably damaging	Het
Olfr290	T	A	7: 84,916,149	Y123*	probably null	Het
Olfr414	T	C	1: 174,430,686	L86P	probably damaging	Het
Pald1	A	T	10: 61,348,661	Y226N	probably damaging	Het
Pcdhb13	G	T	18: 37,444,791	G741C	probably damaging	Het
Pcdhga10	A	G	18: 37,748,206	D340G	probably damaging	Het
Pclo	C	A	5: 14,678,808		probably benign	Het
Pcsk4	G	T	10: 80,323,689	N416K	probably damaging	Het
Pde10a	C	A	17: 8,961,980	R398S	probably damaging	Het
Plin1	T	A	7: 79,725,721	T227S	possibly damaging	Het
Pnpt1	A	G	11: 29,154,166	D542G	probably damaging	Het
Ppp4r3b	T	A	11: 29,211,646	D673E	probably benign	Het
Prr18	C	A	17: 8,341,060	P16Q	probably damaging	Het
Psmc3	T	A	2: 91,059,353	Y440N	probably damaging	Het
Rassf5	T	C	1: 131,180,648	I232V	probably benign	Het
Rims1	T	A	1: 22,538,511	D218V	probably damaging	Het
Skint10	T	C	4: 112,711,593	N309S	possibly damaging	Het
Slc6a1	T	C	6: 114,302,623	M121T	possibly damaging	Het
Slit3	A	G	11: 35,675,913	D1004G	probably damaging	Het
Snap91	C	T	9: 86,835,124	V215I	possibly damaging	Het
Son	T	C	16: 91,655,739	L458S	probably damaging	Het
St18	C	T	1: 6,844,171	A782V	probably damaging	Het
Synpo	A	G	18: 60,602,231		probably null	Het
Thbs3	A	G	3: 89,221,377	D458G	probably damaging	Het
Tpr	C	T	1: 150,445,924	R3C	probably damaging	Het
Trp63	A	G	16: 25,684,355		probably null	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r27	C	A	6: 58,215,596	R141L	probably benign	Het
Wnk1	T	C	6: 119,968,523	I699V	probably benign	Het
Xkr6	A	G	14: 63,818,904	D88G	possibly damaging	Het
Zan	A	G	5: 137,380,788		probably benign	Het
Zbtb7b	T	C	3: 89,379,606		probably benign	Het
Zfp618	A	T	4: 63,080,028	D33V	probably damaging	Het

Other mutations in Ablim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00466:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00478:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00847:Ablim1	APN	19	57152290	missense	possibly damaging	0.59
IGL01063:Ablim1	APN	19	57061328	missense	probably damaging	1.00
IGL01304:Ablim1	APN	19	57215721	missense	probably benign
IGL01385:Ablim1	APN	19	57068914	missense	probably damaging	1.00
IGL01707:Ablim1	APN	19	57039447	missense	probably damaging	1.00
IGL02386:Ablim1	APN	19	57134654	missense	probably damaging	1.00
IGL02427:Ablim1	APN	19	57079880	splice site	probably benign
IGL02498:Ablim1	APN	19	57152319	nonsense	probably null
A9681:Ablim1	UTSW	19	57173323	critical splice donor site	probably null
R0089:Ablim1	UTSW	19	57043031	missense	probably damaging	1.00
R0226:Ablim1	UTSW	19	57043870	missense	probably damaging	1.00
R1419:Ablim1	UTSW	19	57134633	missense	probably damaging	1.00
R1473:Ablim1	UTSW	19	57068236	missense	probably damaging	1.00
R1587:Ablim1	UTSW	19	57083547	start codon destroyed	probably null	0.99
R1588:Ablim1	UTSW	19	57083547	start codon destroyed	probably null	0.99
R1935:Ablim1	UTSW	19	57215965	start gained	probably null
R1936:Ablim1	UTSW	19	57215965	start gained	probably null
R2021:Ablim1	UTSW	19	57047018	missense	probably damaging	0.98
R2110:Ablim1	UTSW	19	57043813	missense	possibly damaging	0.83
R2270:Ablim1	UTSW	19	57077431	missense	possibly damaging	0.58
R2509:Ablim1	UTSW	19	57152359	missense	probably damaging	1.00
R3621:Ablim1	UTSW	19	57152303	missense	probably damaging	0.97
R3732:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3732:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3733:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3734:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3878:Ablim1	UTSW	19	57037210	splice site	probably null
R4354:Ablim1	UTSW	19	57155278	missense	probably damaging	1.00
R4543:Ablim1	UTSW	19	57077442	missense	possibly damaging	0.87
R4749:Ablim1	UTSW	19	57215721	missense	probably benign
R4860:Ablim1	UTSW	19	57079866	missense	probably damaging	1.00
R4860:Ablim1	UTSW	19	57079866	missense	probably damaging	1.00
R5072:Ablim1	UTSW	19	57073853	critical splice donor site	probably null
R5277:Ablim1	UTSW	19	57155261	missense	probably damaging	1.00
R5331:Ablim1	UTSW	19	57155249	missense	probably damaging	1.00
R5893:Ablim1	UTSW	19	57215853	missense	probably benign	0.07
R5958:Ablim1	UTSW	19	57041935	missense	probably damaging	1.00
R6435:Ablim1	UTSW	19	57061355	missense	possibly damaging	0.69
R6460:Ablim1	UTSW	19	57079839	missense	possibly damaging	0.96
R6642:Ablim1	UTSW	19	57130852	missense	probably benign	0.03
R6662:Ablim1	UTSW	19	57073853	critical splice donor site	probably null
R6705:Ablim1	UTSW	19	57215821	missense	probably benign	0.01
R7111:Ablim1	UTSW	19	57073877	missense	probably benign	0.05
R7291:Ablim1	UTSW	19	57215908	missense	probably benign
R7363:Ablim1	UTSW	19	57215741	missense	probably benign	0.10
R7901:Ablim1	UTSW	19	57131002	splice site	probably null
R7974:Ablim1	UTSW	19	57044973	critical splice acceptor site	probably null
R8079:Ablim1	UTSW	19	57182224	critical splice donor site	probably null
R8087:Ablim1	UTSW	19	57182256	missense
R8120:Ablim1	UTSW	19	57046928	missense	probably benign	0.00
R8277:Ablim1	UTSW	19	57215919	missense	probably benign	0.10
R8339:Ablim1	UTSW	19	57043849	missense	probably benign	0.00
R8536:Ablim1	UTSW	19	57182286	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGACTGGTCCTGCTTTCTC -3'
(R):5'- TTGCATGCGTGTTTACATTCAC -3'

Sequencing Primer
(F):5'- GAGTCACTAGCAGTCACATGTCTTG -3'
(R):5'- GCGTGTTTACATTCACTTCAACAG -3'

Posted On

2016-08-04