Mutagenetix > Incidental Mutations

Incidental Mutation 'R5355:Gm8251'

424015

Institutional Source

Beutler Lab

Gene Symbol

Gm8251

Ensembl Gene

ENSMUSG00000091844

Gene Name

predicted gene 8251

Synonyms

MMRRC Submission

042934-MU

Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44055952-44061936 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 44057979 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 1320 (C1320G)

Ref Sequence

ENSEMBL: ENSMUSP00000127017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168641]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168641
AA Change: C1320G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: C1320G

Domain	Start	End	E-Value	Type
Pfam:CCDC168_N	2	202	2.5e-83	PFAM
Pfam:CCDC168_N	200	302	1.7e-26	PFAM
Pfam:CCDC168_N	347	397	2.1e-4	PFAM
Pfam:CCDC168_N	437	581	8.5e-8	PFAM
Pfam:CCDC168_N	663	802	6.3e-5	PFAM
Pfam:CCDC168_N	788	955	1e-9	PFAM
low complexity region	1803	1819	N/A	INTRINSIC
low complexity region	1830	1847	N/A	INTRINSIC
low complexity region	1968	1984	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

94% (50/53)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	C	5: 8,726,873	L857P	probably damaging	Het
Adam12	T	C	7: 133,887,942	*582W	probably null	Het
Adra1d	A	G	2: 131,561,087	V361A	probably damaging	Het
Ank2	A	G	3: 126,944,049		probably benign	Het
Atxn10	T	A	15: 85,462,314	N424K	probably damaging	Het
C8b	A	G	4: 104,780,663	T111A	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdr2l	T	C	11: 115,393,570	V244A	possibly damaging	Het
Col11a2	A	G	17: 34,051,801	M468V	probably benign	Het
Col4a2	G	A	8: 11,445,984	R1535H	probably damaging	Het
Cryab	A	T	9: 50,753,451	S59C	probably damaging	Het
Cuzd1	G	A	7: 131,316,124	T249I	probably damaging	Het
Disp2	G	A	2: 118,786,911	V129M	probably benign	Het
Dlg2	G	T	7: 91,449,803	R31L	probably benign	Het
Dthd1	A	C	5: 62,839,387	L488F	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Fat2	T	G	11: 55,282,166	I2574L	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fryl	T	C	5: 73,073,904	D1610G	probably damaging	Het
Gm10330	T	A	12: 23,780,130	N17Y	probably damaging	Het
Gm4787	T	A	12: 81,377,465	R640*	probably null	Het
Hist1h2bl	A	T	13: 21,715,860	I95N	probably damaging	Het
Ift88	T	A	14: 57,438,242	S71T	probably benign	Het
Isoc2b	A	G	7: 4,849,358		probably benign	Het
Itgb2	G	T	10: 77,558,052	R442L	probably benign	Het
Lama5	A	T	2: 180,181,651	N2658K	possibly damaging	Het
Lemd3	A	T	10: 120,933,633	I598K	probably damaging	Het
Lrp2	A	T	2: 69,454,838	C3825*	probably null	Het
Mep1a	T	C	17: 43,477,146	D673G	probably damaging	Het
Met	A	G	6: 17,491,362	Y41C	probably damaging	Het
Mfn2	A	G	4: 147,894,578	V99A	probably damaging	Het
Mmadhc	A	G	2: 50,291,424	I78T	probably benign	Het
Mmp9	C	A	2: 164,950,992	P389T	possibly damaging	Het
Mvk	T	G	5: 114,452,438	S7A	probably damaging	Het
Nlrp1a	T	A	11: 71,124,251	T58S	probably benign	Het
Nlrp1c-ps	C	A	11: 71,258,013		noncoding transcript	Het
Nr1h3	A	G	2: 91,191,908	I125T	possibly damaging	Het
Olfr1089	A	T	2: 86,733,336	I92K	probably damaging	Het
Olfr443-ps1	C	T	6: 43,094,664		noncoding transcript	Het
Parn	A	G	16: 13,668,022	I3T	possibly damaging	Het
Parp8	A	G	13: 116,862,204		probably null	Het
Parva	T	C	7: 112,544,268		probably null	Het
Pwp2	A	C	10: 78,175,544	I672M	possibly damaging	Het
Sfswap	C	T	5: 129,539,746	T418I	probably benign	Het
Slc6a3	A	G	13: 73,560,959	Y334C	probably damaging	Het
Slc7a13	C	A	4: 19,839,267	T290K	probably benign	Het
Spry2	A	G	14: 105,893,278	L158P	probably damaging	Het
Usp25	A	G	16: 77,050,454	E150G	probably damaging	Het
Zfp747	A	G	7: 127,374,597	F134L	possibly damaging	Het
Zp3r	A	G	1: 130,596,781	F175S	probably benign	Het
Zscan22	C	A	7: 12,906,508	N67K	probably benign	Het

Other mutations in Gm8251

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
D3080:Gm8251	UTSW	1	44067335
R0045:Gm8251	UTSW	1	44057205	missense	probably benign
R0110:Gm8251	UTSW	1	44059224	missense	probably benign
R0450:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0469:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0510:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0602:Gm8251	UTSW	1	44059967	missense	possibly damaging	0.96
R0648:Gm8251	UTSW	1	44056563	missense	possibly damaging	0.73
R0928:Gm8251	UTSW	1	44057228	missense	possibly damaging	0.73
R1056:Gm8251	UTSW	1	44060927	missense	probably damaging	1.00
R1217:Gm8251	UTSW	1	44057179	missense	possibly damaging	0.73
R1232:Gm8251	UTSW	1	44056592	missense	possibly damaging	0.96
R1399:Gm8251	UTSW	1	44061311	missense	possibly damaging	0.93
R1489:Gm8251	UTSW	1	44057790	missense	probably benign	0.18
R1489:Gm8251	UTSW	1	44061507	missense	probably benign	0.06
R1519:Gm8251	UTSW	1	44056970	missense	probably benign	0.33
R1664:Gm8251	UTSW	1	44059227	missense	possibly damaging	0.71
R1828:Gm8251	UTSW	1	44057074	missense	possibly damaging	0.72
R1944:Gm8251	UTSW	1	44061849	missense	probably damaging	0.97
R2032:Gm8251	UTSW	1	44061740	missense	possibly damaging	0.86
R2094:Gm8251	UTSW	1	44059730	missense	probably benign	0.06
R2170:Gm8251	UTSW	1	44056008	missense	probably benign	0.18
R2185:Gm8251	UTSW	1	44061381	missense	probably benign	0.01
R2280:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2281:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2339:Gm8251	UTSW	1	44060863	missense	probably benign
R3617:Gm8251	UTSW	1	44060954	missense	probably benign
R3738:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4012:Gm8251	UTSW	1	44060969	missense	possibly damaging	0.85
R4034:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4344:Gm8251	UTSW	1	44060991	missense	possibly damaging	0.86
R4436:Gm8251	UTSW	1	44056116	missense	probably benign	0.03
R4485:Gm8251	UTSW	1	44060123	missense	probably benign
R4735:Gm8251	UTSW	1	44061701	missense	probably benign
R4782:Gm8251	UTSW	1	44059043	missense	possibly damaging	0.85
R4837:Gm8251	UTSW	1	44061434	missense	possibly damaging	0.93
R4862:Gm8251	UTSW	1	44058018	missense	possibly damaging	0.93
R5247:Gm8251	UTSW	1	44057006	nonsense	probably null
R5347:Gm8251	UTSW	1	44057795	missense	probably benign	0.01
R5559:Gm8251	UTSW	1	44058515	missense	possibly damaging	0.77
R5640:Gm8251	UTSW	1	44061927	missense	probably benign	0.00
R5681:Gm8251	UTSW	1	44061464	missense	possibly damaging	0.93
R5776:Gm8251	UTSW	1	44056505	missense	possibly damaging	0.72
R5919:Gm8251	UTSW	1	44056986	missense	probably benign
R5987:Gm8251	UTSW	1	44057257	missense	probably benign
R6616:Gm8251	UTSW	1	44061474	missense	possibly damaging	0.51
R6677:Gm8251	UTSW	1	44058699	missense	probably benign	0.00
R6830:Gm8251	UTSW	1	44056730	missense	probably benign	0.33
R6906:Gm8251	UTSW	1	44056013	missense	probably benign	0.33
R6909:Gm8251	UTSW	1	44059775	missense	possibly damaging	0.71
R6957:Gm8251	UTSW	1	44057207	missense	probably benign	0.00
R7008:Gm8251	UTSW	1	44059625	missense	probably benign
R7052:Gm8251	UTSW	1	44057306	missense	possibly damaging	0.53
R7176:Gm8251	UTSW	1	44060346	missense	probably benign	0.00
R7190:Gm8251	UTSW	1	44061615	missense	probably benign	0.32
R7296:Gm8251	UTSW	1	44060916	nonsense	probably null
R7347:Gm8251	UTSW	1	44059496	missense	probably damaging	0.99
R7371:Gm8251	UTSW	1	44061377	missense	probably benign
R7375:Gm8251	UTSW	1	44060534	missense	possibly damaging	0.53
R7442:Gm8251	UTSW	1	44058708	missense	possibly damaging	0.84
R7450:Gm8251	UTSW	1	44058773	missense	probably benign	0.33
R7574:Gm8251	UTSW	1	44059433	missense	possibly damaging	0.93
R7586:Gm8251	UTSW	1	44060013	missense	probably benign	0.20
R7739:Gm8251	UTSW	1	44056418	missense	possibly damaging	0.86
R7878:Gm8251	UTSW	1	44056014	missense	probably benign	0.18
R7959:Gm8251	UTSW	1	44057568	missense	probably benign
R7991:Gm8251	UTSW	1	44059709	missense	probably benign	0.00
R8035:Gm8251	UTSW	1	44061551	missense	possibly damaging	0.51
R8281:Gm8251	UTSW	1	44056538	missense	possibly damaging	0.93
R8523:Gm8251	UTSW	1	44060834	missense	possibly damaging	0.86
YA93:Gm8251	UTSW	1	44065085	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTTTTGAAATAGTCCCTTGGGG -3'
(R):5'- AACTCATTTGACACTGGGGAAGC -3'

Sequencing Primer
(F):5'- GGCGAGAGTCACGGTTCTG -3'
(R):5'- GGAACTGTGCACATATTTCCTG -3'

Posted On

2016-08-04