Incidental Mutation 'R5355:Mmadhc'
ID424018
Institutional Source Beutler Lab
Gene Symbol Mmadhc
Ensembl Gene ENSMUSG00000026766
Gene Namemethylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Synonyms2010311D03Rik
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location50279881-50296801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50291424 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 78 (I78T)
Ref Sequence ENSEMBL: ENSMUSP00000099830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102769] [ENSMUST00000133768] [ENSMUST00000144143]
Predicted Effect probably benign
Transcript: ENSMUST00000102769
AA Change: I78T

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099830
Gene: ENSMUSG00000026766
AA Change: I78T

DomainStartEndE-ValueType
Pfam:DUF2246 24 294 8.5e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133768
AA Change: I78T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000115961
Gene: ENSMUSG00000026766
AA Change: I78T

DomainStartEndE-ValueType
Pfam:DUF2246 20 179 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140563
Predicted Effect probably benign
Transcript: ENSMUST00000144143
AA Change: I78T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122804
Gene: ENSMUSG00000026766
AA Change: I78T

DomainStartEndE-ValueType
Pfam:DUF2246 20 219 1.5e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154254
Meta Mutation Damage Score 0.3432 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that is involved in an early step of vitamin B12 metabolism. Vitamin B12 (cobalamin) is essential for normal development and survival in humans. Mutations in this gene cause methylmalonic aciduria and homocystinuria type cblD (MMADHC), a disorder of cobalamin metabolism that is characterized by decreased levels of the coenzymes adenosylcobalamin and methylcobalamin. Pseudogenes have been identified on chromosomes 11 and X.[provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Mmadhc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Mmadhc APN 2 50289031 missense probably benign
IGL01732:Mmadhc APN 2 50281185 missense probably damaging 1.00
IGL02397:Mmadhc APN 2 50288980 missense possibly damaging 0.82
R0091:Mmadhc UTSW 2 50292857 missense probably damaging 1.00
R0458:Mmadhc UTSW 2 50281161 missense probably benign 0.01
R0573:Mmadhc UTSW 2 50292835 missense possibly damaging 0.79
R1613:Mmadhc UTSW 2 50280326 missense probably damaging 1.00
R2189:Mmadhc UTSW 2 50288946 missense probably damaging 1.00
R4092:Mmadhc UTSW 2 50287883 missense probably benign
R4214:Mmadhc UTSW 2 50291332 missense probably benign
R4498:Mmadhc UTSW 2 50280224 missense probably benign 0.25
R5961:Mmadhc UTSW 2 50291409 missense probably damaging 1.00
R7343:Mmadhc UTSW 2 50291445 missense probably damaging 1.00
X0018:Mmadhc UTSW 2 50287917 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGAAAAGGCTGGTTATGCTGC -3'
(R):5'- ACTACAGCTCCCTGGTTTTG -3'

Sequencing Primer
(F):5'- AAAGGCTGGTTATGCTGCTTTTATAC -3'
(R):5'- ACAGCTCCCTGGTTTTGATTTTTG -3'
Posted On2016-08-04