Incidental Mutation 'R0488:Rsg1'
ID42402
Institutional Source Beutler Lab
Gene Symbol Rsg1
Ensembl Gene ENSMUSG00000073733
Gene NameREM2 and RAB-like small GTPase 1
SynonymsLOC279260, 6330545A04Rik
MMRRC Submission 038687-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R0488 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141213956-141226756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141214401 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 14 (D14G)
Ref Sequence ENSEMBL: ENSMUSP00000095422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097813]
Predicted Effect probably benign
Transcript: ENSMUST00000097813
AA Change: D14G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095422
Gene: ENSMUSG00000073733
AA Change: D14G

DomainStartEndE-ValueType
Pfam:Roc 57 179 7.3e-9 PFAM
Pfam:Ras 57 207 4.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151475
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular defects including persistent truncus arteriosus and atrioventricular septal defects, as well as polydactyly and micrognathia. Eye defects, hypoplastic lungs and thymus, and tracheoesophageal anomalies may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T G 11: 46,138,930 L734R probably damaging Het
Adgrf1 T C 17: 43,310,411 I513T probably damaging Het
Adgrl2 A G 3: 148,846,905 V654A probably damaging Het
Agl A T 3: 116,754,962 Y1249* probably null Het
Ankar T A 1: 72,658,732 Q996H probably damaging Het
Aqp12 T C 1: 93,008,656 Y235H probably damaging Het
Arsb T C 13: 93,940,505 V460A probably benign Het
Baiap3 A G 17: 25,248,470 probably null Het
Cd44 T C 2: 102,834,219 probably benign Het
Clec4b1 T A 6: 123,071,482 I192N probably damaging Het
Cps1 A C 1: 67,148,808 probably benign Het
Dab2 T C 15: 6,424,654 L215S probably damaging Het
E2f4 G A 8: 105,298,539 V84I probably damaging Het
Edem2 T C 2: 155,716,123 T197A probably damaging Het
Eno2 T A 6: 124,763,874 M121L probably benign Het
Ephb1 A G 9: 101,964,008 V757A probably damaging Het
Etv5 T A 16: 22,412,945 I106F probably damaging Het
Foxj3 T A 4: 119,619,990 Y298* probably null Het
Gm12185 A G 11: 48,907,839 L609S probably damaging Het
Gm5884 T C 6: 128,646,068 noncoding transcript Het
Havcr1 A G 11: 46,752,571 Y106C probably damaging Het
Jmjd1c A G 10: 67,240,727 N2110S probably damaging Het
Kif2b T C 11: 91,576,972 K162E probably benign Het
Micu2 T C 14: 57,932,242 Y217C probably benign Het
Mink1 G T 11: 70,597,204 G32C probably damaging Het
Mnat1 T A 12: 73,170,639 N96K probably damaging Het
Mpp2 G T 11: 102,061,601 R349S possibly damaging Het
Mrpl13 T A 15: 55,539,148 I59F probably benign Het
Mybl2 T C 2: 163,072,614 probably benign Het
Otogl T C 10: 107,803,605 E1382G probably benign Het
Pclo A G 5: 14,669,299 E1150G unknown Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pla2g4a G A 1: 149,871,445 T322M probably damaging Het
Pramef6 A T 4: 143,895,403 Y461N probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptprg A T 14: 12,220,653 D455V probably damaging Het
Ptprt T C 2: 161,553,825 T1162A probably damaging Het
Rad51ap1 T C 6: 126,934,760 N55D possibly damaging Het
Rc3h2 T C 2: 37,389,588 E543G probably damaging Het
Rimklb G A 6: 122,460,975 T103I probably benign Het
Samd4b T C 7: 28,414,237 Y101C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tubgcp5 T A 7: 55,829,338 S979T probably damaging Het
Vmn2r93 G A 17: 18,326,049 E728K probably damaging Het
Wdr17 T C 8: 54,693,052 probably benign Het
Wdr90 T C 17: 25,848,617 Y1457C probably damaging Het
Wsb1 T C 11: 79,244,500 D225G probably damaging Het
Xirp2 T C 2: 67,514,821 S2469P possibly damaging Het
Zeb1 T A 18: 5,772,455 C915S probably damaging Het
Znfx1 C A 2: 167,042,563 R923L possibly damaging Het
Other mutations in Rsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Rsg1 APN 4 141218653 missense probably benign 0.01
R0967:Rsg1 UTSW 4 141219851 missense probably benign 0.01
R1339:Rsg1 UTSW 4 141218548 missense probably damaging 1.00
R1460:Rsg1 UTSW 4 141218212 missense probably damaging 0.97
R3826:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3828:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3829:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3830:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R5076:Rsg1 UTSW 4 141217385 missense probably benign 0.00
R5242:Rsg1 UTSW 4 141219847 missense probably damaging 1.00
R5527:Rsg1 UTSW 4 141219992 missense probably damaging 1.00
R5610:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R5677:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R6049:Rsg1 UTSW 4 141218162 missense probably benign 0.18
R6543:Rsg1 UTSW 4 141217288 missense probably benign
R7078:Rsg1 UTSW 4 141219848 missense probably benign 0.01
R7483:Rsg1 UTSW 4 141219842 missense probably damaging 1.00
R8046:Rsg1 UTSW 4 141220037 missense probably damaging 1.00
R8169:Rsg1 UTSW 4 141218219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAGGTTCCAAAGGAAAGCCAG -3'
(R):5'- AGTGAGGGCTCAGTCAACAGCATC -3'

Sequencing Primer
(F):5'- CCAGAGAGAGATTAAGGACCTCG -3'
(R):5'- ACAGCATCTCTGGTGACAG -3'
Posted On2013-05-23