Incidental Mutation 'R5355:Nr1h3'
ID424021
Institutional Source Beutler Lab
Gene Symbol Nr1h3
Ensembl Gene ENSMUSG00000002108
Gene Namenuclear receptor subfamily 1, group H, member 3
SynonymsUnr1, LXR alpha
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91184061-91202834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91191908 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 125 (I125T)
Ref Sequence ENSEMBL: ENSMUSP00000106988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002177] [ENSMUST00000111354] [ENSMUST00000111355] [ENSMUST00000111356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002177
AA Change: I125T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002177
Gene: ENSMUSG00000002108
AA Change: I125T

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111354
AA Change: I125T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106986
Gene: ENSMUSG00000002108
AA Change: I125T

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111355
AA Change: I125T

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106987
Gene: ENSMUSG00000002108
AA Change: I125T

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
HOLI 202 356 3.76e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111356
AA Change: I125T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106988
Gene: ENSMUSG00000002108
AA Change: I125T

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150654
Meta Mutation Damage Score 0.1426 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased male fertility, increased suseceptibility to bacterial infection, and diet-sensitive increase in liver size, steatosis, and cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Nr1h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nr1h3 APN 2 91190199 missense probably damaging 1.00
IGL02198:Nr1h3 APN 2 91192725 missense probably damaging 1.00
IGL02992:Nr1h3 APN 2 91190566 missense probably damaging 1.00
IGL03103:Nr1h3 APN 2 91192015 missense probably damaging 1.00
R0302:Nr1h3 UTSW 2 91192013 missense probably damaging 0.98
R0350:Nr1h3 UTSW 2 91191825 missense possibly damaging 0.68
R2397:Nr1h3 UTSW 2 91191857 missense possibly damaging 0.81
R2439:Nr1h3 UTSW 2 91190220 missense probably benign 0.45
R2988:Nr1h3 UTSW 2 91185004 missense probably damaging 0.96
R3431:Nr1h3 UTSW 2 91191860 missense probably damaging 1.00
R4842:Nr1h3 UTSW 2 91190218 missense probably benign 0.09
R6137:Nr1h3 UTSW 2 91191851 missense probably damaging 1.00
R6982:Nr1h3 UTSW 2 91190759 missense probably damaging 0.98
R7380:Nr1h3 UTSW 2 91190195 missense possibly damaging 0.83
R7531:Nr1h3 UTSW 2 91184394 missense probably damaging 1.00
R7753:Nr1h3 UTSW 2 91185025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAAGTGTAAGCATCTGTC -3'
(R):5'- TGGAGAATGCCTAGCTAGGAGC -3'

Sequencing Primer
(F):5'- AAGTGTAAGCATCTGTCTGTCTTCAC -3'
(R):5'- GAGGGAGAACATTAAATCTTGTGTC -3'
Posted On2016-08-04