Incidental Mutation 'R5355:Adra1d'
ID424024
Institutional Source Beutler Lab
Gene Symbol Adra1d
Ensembl Gene ENSMUSG00000027335
Gene Nameadrenergic receptor, alpha 1d
SynonymsAdra1, Gpcr8, alpha1D-AR, Adra1a, Adra-1
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131545850-131562283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131561087 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 361 (V361A)
Ref Sequence ENSEMBL: ENSMUSP00000099473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103184]
Predicted Effect probably damaging
Transcript: ENSMUST00000103184
AA Change: V361A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099473
Gene: ENSMUSG00000027335
AA Change: V361A

DomainStartEndE-ValueType
low complexity region 13 57 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 98 228 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 101 411 8.9e-14 PFAM
Pfam:7tm_1 107 396 4.5e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146049
Meta Mutation Damage Score 0.1395 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1D-adrenergic receptor. Similar to alpha-1B-adrenergic receptor gene, this gene comprises 2 exons and a single intron that interrupts the coding region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display hypotension or reduced rearing behavior in a novel environment, decreased wheel-running activity during the night, and reduced hyperlocomotion after amphetamine administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Adra1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adra1d APN 2 131561677 missense possibly damaging 0.83
IGL02198:Adra1d APN 2 131546492 missense probably damaging 0.99
IGL02901:Adra1d APN 2 131561604 missense probably damaging 1.00
IGL03155:Adra1d APN 2 131546081 missense probably benign 0.00
R0238:Adra1d UTSW 2 131546214 missense probably benign 0.01
R0239:Adra1d UTSW 2 131546214 missense probably benign 0.01
R0239:Adra1d UTSW 2 131546214 missense probably benign 0.01
R1568:Adra1d UTSW 2 131546172 missense possibly damaging 0.88
R1806:Adra1d UTSW 2 131546149 missense probably benign 0.31
R2192:Adra1d UTSW 2 131561369 missense probably damaging 1.00
R2510:Adra1d UTSW 2 131562135 nonsense probably null
R3913:Adra1d UTSW 2 131562155 missense probably damaging 0.98
R4660:Adra1d UTSW 2 131561142 missense probably damaging 1.00
R5303:Adra1d UTSW 2 131546249 missense possibly damaging 0.87
R5428:Adra1d UTSW 2 131561403 missense probably damaging 1.00
R6277:Adra1d UTSW 2 131561163 missense probably damaging 1.00
R6392:Adra1d UTSW 2 131561609 missense probably damaging 1.00
R7200:Adra1d UTSW 2 131561250 missense probably benign 0.00
R7779:Adra1d UTSW 2 131561885 missense probably damaging 0.99
R8070:Adra1d UTSW 2 131561582 missense probably damaging 1.00
R8135:Adra1d UTSW 2 131561772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGACCGAGGTTTGTAACATC -3'
(R):5'- TTCTGAGGATCCACTGTCGC -3'

Sequencing Primer
(F):5'- GAAAGAGTGAGAAGCCTGTTTAAG -3'
(R):5'- TAGCGCCAAAGGAAATCC -3'
Posted On2016-08-04