Incidental Mutation 'R5355:Slc7a13'
ID 424028
Institutional Source Beutler Lab
Gene Symbol Slc7a13
Ensembl Gene ENSMUSG00000041052
Gene Name solute carrier family 7, (cationic amino acid transporter, y+ system) member 13
Synonyms AGT-1, XAT2, 0610009O04Rik, AGT1
MMRRC Submission 042934-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5355 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 19818727-19842213 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 19839267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 290 (T290K)
Ref Sequence ENSEMBL: ENSMUSP00000036228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035890]
AlphaFold Q91WN3
Predicted Effect probably benign
Transcript: ENSMUST00000035890
AA Change: T290K

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036228
Gene: ENSMUSG00000041052
AA Change: T290K

DomainStartEndE-ValueType
Pfam:AA_permease_2 17 440 3.3e-44 PFAM
Pfam:AA_permease 21 454 3.7e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,776,873 (GRCm39) L857P probably damaging Het
Adam12 T C 7: 133,489,671 (GRCm39) *582W probably null Het
Adra1d A G 2: 131,403,007 (GRCm39) V361A probably damaging Het
Ank2 A G 3: 126,737,698 (GRCm39) probably benign Het
Atxn10 T A 15: 85,346,515 (GRCm39) N424K probably damaging Het
C8b A G 4: 104,637,860 (GRCm39) T111A probably benign Het
Ccdc168 A C 1: 44,097,139 (GRCm39) C1320G possibly damaging Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Cdr2l T C 11: 115,284,396 (GRCm39) V244A possibly damaging Het
Col11a2 A G 17: 34,270,775 (GRCm39) M468V probably benign Het
Col4a2 G A 8: 11,495,984 (GRCm39) R1535H probably damaging Het
Cryab A T 9: 50,664,751 (GRCm39) S59C probably damaging Het
Cuzd1 G A 7: 130,917,853 (GRCm39) T249I probably damaging Het
Disp2 G A 2: 118,617,392 (GRCm39) V129M probably benign Het
Dlg2 G T 7: 91,099,011 (GRCm39) R31L probably benign Het
Dthd1 A C 5: 62,996,730 (GRCm39) L488F probably damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
Fat2 T G 11: 55,172,992 (GRCm39) I2574L probably damaging Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Fryl T C 5: 73,231,247 (GRCm39) D1610G probably damaging Het
Gm10330 T A 12: 23,830,131 (GRCm39) N17Y probably damaging Het
Gm4787 T A 12: 81,424,239 (GRCm39) R640* probably null Het
H2bc13 A T 13: 21,900,030 (GRCm39) I95N probably damaging Het
Ift88 T A 14: 57,675,699 (GRCm39) S71T probably benign Het
Isoc2b A G 7: 4,852,357 (GRCm39) probably benign Het
Itgb2 G T 10: 77,393,886 (GRCm39) R442L probably benign Het
Lama5 A T 2: 179,823,444 (GRCm39) N2658K possibly damaging Het
Lemd3 A T 10: 120,769,538 (GRCm39) I598K probably damaging Het
Lrp2 A T 2: 69,285,182 (GRCm39) C3825* probably null Het
Mep1a T C 17: 43,788,037 (GRCm39) D673G probably damaging Het
Met A G 6: 17,491,361 (GRCm39) Y41C probably damaging Het
Mfn2 A G 4: 147,979,035 (GRCm39) V99A probably damaging Het
Mmadhc A G 2: 50,181,436 (GRCm39) I78T probably benign Het
Mmp9 C A 2: 164,792,912 (GRCm39) P389T possibly damaging Het
Mvk T G 5: 114,590,499 (GRCm39) S7A probably damaging Het
Nlrp1a T A 11: 71,015,077 (GRCm39) T58S probably benign Het
Nlrp1c-ps C A 11: 71,148,839 (GRCm39) noncoding transcript Het
Nr1h3 A G 2: 91,022,253 (GRCm39) I125T possibly damaging Het
Or2a55-ps1 C T 6: 43,071,598 (GRCm39) noncoding transcript Het
Or8k39 A T 2: 86,563,680 (GRCm39) I92K probably damaging Het
Parn A G 16: 13,485,886 (GRCm39) I3T possibly damaging Het
Parp8 A G 13: 116,998,740 (GRCm39) probably null Het
Parva T C 7: 112,143,475 (GRCm39) probably null Het
Pwp2 A C 10: 78,011,378 (GRCm39) I672M possibly damaging Het
Sfswap C T 5: 129,616,810 (GRCm39) T418I probably benign Het
Slc6a3 A G 13: 73,709,078 (GRCm39) Y334C probably damaging Het
Spry2 A G 14: 106,130,712 (GRCm39) L158P probably damaging Het
Usp25 A G 16: 76,847,342 (GRCm39) E150G probably damaging Het
Zfp747 A G 7: 126,973,769 (GRCm39) F134L possibly damaging Het
Zp3r A G 1: 130,524,518 (GRCm39) F175S probably benign Het
Zscan22 C A 7: 12,640,435 (GRCm39) N67K probably benign Het
Other mutations in Slc7a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Slc7a13 APN 4 19,839,527 (GRCm39) missense probably benign 0.00
IGL02491:Slc7a13 APN 4 19,841,404 (GRCm39) missense probably damaging 0.98
IGL02541:Slc7a13 APN 4 19,839,212 (GRCm39) splice site probably benign
IGL02814:Slc7a13 APN 4 19,839,387 (GRCm39) missense probably benign
R0145:Slc7a13 UTSW 4 19,818,782 (GRCm39) start gained probably benign
R0305:Slc7a13 UTSW 4 19,839,401 (GRCm39) missense probably benign 0.12
R0468:Slc7a13 UTSW 4 19,841,500 (GRCm39) missense probably benign 0.04
R0522:Slc7a13 UTSW 4 19,824,010 (GRCm39) missense probably benign 0.02
R0848:Slc7a13 UTSW 4 19,818,866 (GRCm39) missense probably benign 0.00
R1240:Slc7a13 UTSW 4 19,819,212 (GRCm39) missense probably damaging 1.00
R1623:Slc7a13 UTSW 4 19,824,031 (GRCm39) missense possibly damaging 0.84
R1830:Slc7a13 UTSW 4 19,819,046 (GRCm39) missense probably benign 0.33
R1903:Slc7a13 UTSW 4 19,839,254 (GRCm39) missense probably benign 0.01
R1952:Slc7a13 UTSW 4 19,841,578 (GRCm39) missense probably benign
R2229:Slc7a13 UTSW 4 19,839,399 (GRCm39) missense probably benign 0.43
R2887:Slc7a13 UTSW 4 19,819,052 (GRCm39) missense possibly damaging 0.69
R4175:Slc7a13 UTSW 4 19,819,492 (GRCm39) missense probably null 0.99
R4233:Slc7a13 UTSW 4 19,819,070 (GRCm39) missense probably damaging 0.97
R4764:Slc7a13 UTSW 4 19,819,390 (GRCm39) missense probably benign 0.08
R4941:Slc7a13 UTSW 4 19,841,467 (GRCm39) missense probably damaging 1.00
R6221:Slc7a13 UTSW 4 19,839,305 (GRCm39) missense probably benign 0.00
R6641:Slc7a13 UTSW 4 19,839,534 (GRCm39) missense probably damaging 1.00
R7237:Slc7a13 UTSW 4 19,839,364 (GRCm39) missense probably benign
R8188:Slc7a13 UTSW 4 19,819,082 (GRCm39) missense probably benign 0.03
R8384:Slc7a13 UTSW 4 19,823,984 (GRCm39) missense probably damaging 1.00
R8753:Slc7a13 UTSW 4 19,841,443 (GRCm39) missense probably damaging 0.99
R8830:Slc7a13 UTSW 4 19,819,189 (GRCm39) missense probably benign 0.01
R9140:Slc7a13 UTSW 4 19,819,487 (GRCm39) missense possibly damaging 0.72
R9663:Slc7a13 UTSW 4 19,818,818 (GRCm39) missense possibly damaging 0.84
R9764:Slc7a13 UTSW 4 19,819,033 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTATTCATGGTGTAGTATGGTGAAC -3'
(R):5'- GCCATACTGATAATTAGTAGCACAG -3'

Sequencing Primer
(F):5'- TGGTGAACAAAAATACTGTTGAAGTG -3'
(R):5'- TTAGTAGCACAGCTATAAAGGGAG -3'
Posted On 2016-08-04