Incidental Mutation 'R5355:Slc7a13'
ID424028
Institutional Source Beutler Lab
Gene Symbol Slc7a13
Ensembl Gene ENSMUSG00000041052
Gene Namesolute carrier family 7, (cationic amino acid transporter, y+ system) member 13
SynonymsAGT1, XAT2, AGT-1, 0610009O04Rik
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location19818725-19842218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19839267 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 290 (T290K)
Ref Sequence ENSEMBL: ENSMUSP00000036228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035890]
Predicted Effect probably benign
Transcript: ENSMUST00000035890
AA Change: T290K

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036228
Gene: ENSMUSG00000041052
AA Change: T290K

DomainStartEndE-ValueType
Pfam:AA_permease_2 17 440 3.3e-44 PFAM
Pfam:AA_permease 21 454 3.7e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Slc7a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Slc7a13 APN 4 19839527 missense probably benign 0.00
IGL02491:Slc7a13 APN 4 19841404 missense probably damaging 0.98
IGL02541:Slc7a13 APN 4 19839212 splice site probably benign
IGL02814:Slc7a13 APN 4 19839387 missense probably benign
R0145:Slc7a13 UTSW 4 19818782 start gained probably benign
R0305:Slc7a13 UTSW 4 19839401 missense probably benign 0.12
R0468:Slc7a13 UTSW 4 19841500 missense probably benign 0.04
R0522:Slc7a13 UTSW 4 19824010 missense probably benign 0.02
R0848:Slc7a13 UTSW 4 19818866 missense probably benign 0.00
R1240:Slc7a13 UTSW 4 19819212 missense probably damaging 1.00
R1623:Slc7a13 UTSW 4 19824031 missense possibly damaging 0.84
R1830:Slc7a13 UTSW 4 19819046 missense probably benign 0.33
R1903:Slc7a13 UTSW 4 19839254 missense probably benign 0.01
R1952:Slc7a13 UTSW 4 19841578 missense probably benign
R2229:Slc7a13 UTSW 4 19839399 missense probably benign 0.43
R2887:Slc7a13 UTSW 4 19819052 missense possibly damaging 0.69
R4175:Slc7a13 UTSW 4 19819492 missense probably null 0.99
R4233:Slc7a13 UTSW 4 19819070 missense probably damaging 0.97
R4764:Slc7a13 UTSW 4 19819390 missense probably benign 0.08
R4941:Slc7a13 UTSW 4 19841467 missense probably damaging 1.00
R6221:Slc7a13 UTSW 4 19839305 missense probably benign 0.00
R6641:Slc7a13 UTSW 4 19839534 missense probably damaging 1.00
R7237:Slc7a13 UTSW 4 19839364 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTATTCATGGTGTAGTATGGTGAAC -3'
(R):5'- GCCATACTGATAATTAGTAGCACAG -3'

Sequencing Primer
(F):5'- TGGTGAACAAAAATACTGTTGAAGTG -3'
(R):5'- TTAGTAGCACAGCTATAAAGGGAG -3'
Posted On2016-08-04