Incidental Mutation 'R5355:C8b'
ID424029
Institutional Source Beutler Lab
Gene Symbol C8b
Ensembl Gene ENSMUSG00000029656
Gene Namecomplement component 8, beta polypeptide
Synonyms4930439B20Rik
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location104766317-104804548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104780663 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 111 (T111A)
Ref Sequence ENSEMBL: ENSMUSP00000066940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]
Predicted Effect probably benign
Transcript: ENSMUST00000031663
AA Change: T111A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: T111A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 290 497 3.6e-65 SMART
Blast:EGF 501 534 9e-12 BLAST
TSP1 547 584 1.17e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065072
AA Change: T111A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656
AA Change: T111A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 224 431 3.6e-65 SMART
Blast:EGF 435 468 1e-11 BLAST
TSP1 481 518 1.17e-1 SMART
Meta Mutation Damage Score 0.1107 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in C8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:C8b APN 4 104801334 splice site probably benign
IGL01145:C8b APN 4 104780580 missense probably benign 0.25
IGL01768:C8b APN 4 104786954 missense probably benign 0.00
IGL02347:C8b APN 4 104786954 missense probably benign 0.00
IGL02488:C8b APN 4 104804081 missense probably benign
IGL02957:C8b APN 4 104766455 missense probably benign
IGL02979:C8b APN 4 104774388 missense probably damaging 0.99
IGL02995:C8b APN 4 104801328 splice site probably benign
IGL03294:C8b APN 4 104780691 missense probably benign 0.06
R0568:C8b UTSW 4 104793380 missense probably benign 0.39
R1015:C8b UTSW 4 104786960 missense probably benign 0.19
R1191:C8b UTSW 4 104793323 missense probably damaging 1.00
R1401:C8b UTSW 4 104784482 missense possibly damaging 0.72
R3824:C8b UTSW 4 104783009 missense probably benign 0.42
R4611:C8b UTSW 4 104790644 missense probably damaging 0.98
R4756:C8b UTSW 4 104786886 missense probably benign
R4845:C8b UTSW 4 104791812 missense possibly damaging 0.87
R5436:C8b UTSW 4 104800349 nonsense probably null
R5561:C8b UTSW 4 104784448 missense possibly damaging 0.89
R5967:C8b UTSW 4 104793333 missense possibly damaging 0.79
R6744:C8b UTSW 4 104774346 missense probably damaging 1.00
R6899:C8b UTSW 4 104786874 missense probably benign 0.02
R6977:C8b UTSW 4 104786996 missense possibly damaging 0.82
R7088:C8b UTSW 4 104793343 missense probably benign 0.12
R7224:C8b UTSW 4 104780598 missense probably damaging 1.00
R7278:C8b UTSW 4 104780627 missense probably damaging 1.00
R8058:C8b UTSW 4 104790614 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGCCAACTGTATGCCTTC -3'
(R):5'- GGTTTGTGGTAAGGAATCCTCC -3'

Sequencing Primer
(F):5'- CAGCATCCACAGCTTGGTTTGG -3'
(R):5'- GGAATCCTCCTGACCTGTCCTG -3'
Posted On2016-08-04