Incidental Mutation 'R5355:Dthd1'
ID424032
Institutional Source Beutler Lab
Gene Symbol Dthd1
Ensembl Gene ENSMUSG00000090326
Gene Namedeath domain containing 1
SynonymsGm17384
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location62813823-62888308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 62839387 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 488 (L488F)
Ref Sequence ENSEMBL: ENSMUSP00000131534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170704]
Predicted Effect probably damaging
Transcript: ENSMUST00000170704
AA Change: L488F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131534
Gene: ENSMUSG00000090326
AA Change: L488F

DomainStartEndE-ValueType
Pfam:Death 693 778 4.2e-12 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a death domain. Death domain-containing proteins function in signaling pathways and formation of signaling complexes, as well as the apoptosis pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Dthd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4342:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4589:Dthd1 UTSW 5 62843026 frame shift probably null
FR4976:Dthd1 UTSW 5 62843024 small insertion probably benign
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0395:Dthd1 UTSW 5 62814333 missense possibly damaging 0.71
R0734:Dthd1 UTSW 5 62839410 splice site probably benign
R0899:Dthd1 UTSW 5 62842928 missense probably benign 0.01
R0970:Dthd1 UTSW 5 62887981 missense probably damaging 1.00
R1104:Dthd1 UTSW 5 62821959 missense probably damaging 1.00
R1518:Dthd1 UTSW 5 62822040 missense probably damaging 1.00
R1831:Dthd1 UTSW 5 62827229 missense probably benign 0.02
R2110:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2110:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2112:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2112:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2248:Dthd1 UTSW 5 62849900 missense probably damaging 0.99
R2311:Dthd1 UTSW 5 62839237 splice site probably benign
R2937:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R2938:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R3835:Dthd1 UTSW 5 62849785 missense probably damaging 1.00
R3855:Dthd1 UTSW 5 62827129 missense probably benign 0.21
R3855:Dthd1 UTSW 5 62888023 missense probably benign 0.00
R4049:Dthd1 UTSW 5 62827165 nonsense probably null
R4321:Dthd1 UTSW 5 62818690 missense probably damaging 0.99
R4353:Dthd1 UTSW 5 62842867 missense probably benign 0.04
R4560:Dthd1 UTSW 5 62827092 missense probably damaging 1.00
R4613:Dthd1 UTSW 5 62827068 missense probably damaging 1.00
R4689:Dthd1 UTSW 5 62842912 missense probably damaging 0.99
R4715:Dthd1 UTSW 5 62888187 missense probably benign
R4718:Dthd1 UTSW 5 62818793 missense probably damaging 1.00
R4967:Dthd1 UTSW 5 62888206 missense probably benign 0.01
R5068:Dthd1 UTSW 5 62818716 missense probably benign
R5089:Dthd1 UTSW 5 62849905 missense probably benign
R5470:Dthd1 UTSW 5 62818766 missense probably damaging 1.00
R6284:Dthd1 UTSW 5 62814041 missense possibly damaging 0.71
R6293:Dthd1 UTSW 5 62842850 missense probably damaging 0.99
R6484:Dthd1 UTSW 5 62814332 missense probably benign 0.34
R6516:Dthd1 UTSW 5 62839264 missense probably benign 0.16
R6741:Dthd1 UTSW 5 62842946 missense probably damaging 1.00
R6810:Dthd1 UTSW 5 62814329 missense probably benign 0.01
R7565:Dthd1 UTSW 5 62843092 missense probably damaging 1.00
R7595:Dthd1 UTSW 5 62818715 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CATCTTTCTATTCTTGACATCAGGG -3'
(R):5'- GCAATCAGAGGAACCATGTCAATTG -3'

Sequencing Primer
(F):5'- TGCTATGCAAATTTTCCCCAC -3'
(R):5'- GTGGTTTGCATTTCTAAGTACACC -3'
Posted On2016-08-04