Mutagenetix > Incidental Mutations

Incidental Mutation 'R5355:Met'

424036

Institutional Source

Beutler Lab

Gene Symbol

Met

Ensembl Gene

ENSMUSG00000009376

Gene Name

met proto-oncogene

Synonyms

Par4, HGF receptor, c-Met

MMRRC Submission

042934-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17463800-17573980 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17491362 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 41 (Y41C)

Ref Sequence

ENSEMBL: ENSMUSP00000117856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443] [ENSMUST00000140070]

Predicted Effect

probably damaging
Transcript: ENSMUST00000080469
AA Change: Y41C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: Y41C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115442
AA Change: Y41C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: Y41C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115443
AA Change: Y41C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: Y41C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000140070
AA Change: Y41C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117856
Gene: ENSMUSG00000009376
AA Change: Y41C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Sema	52	169	4.8e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145473

Meta Mutation Damage Score

0.4037

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

94% (50/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	C	5: 8,726,873	L857P	probably damaging	Het
Adam12	T	C	7: 133,887,942	*582W	probably null	Het
Adra1d	A	G	2: 131,561,087	V361A	probably damaging	Het
Ank2	A	G	3: 126,944,049		probably benign	Het
Atxn10	T	A	15: 85,462,314	N424K	probably damaging	Het
C8b	A	G	4: 104,780,663	T111A	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdr2l	T	C	11: 115,393,570	V244A	possibly damaging	Het
Col11a2	A	G	17: 34,051,801	M468V	probably benign	Het
Col4a2	G	A	8: 11,445,984	R1535H	probably damaging	Het
Cryab	A	T	9: 50,753,451	S59C	probably damaging	Het
Cuzd1	G	A	7: 131,316,124	T249I	probably damaging	Het
Disp2	G	A	2: 118,786,911	V129M	probably benign	Het
Dlg2	G	T	7: 91,449,803	R31L	probably benign	Het
Dthd1	A	C	5: 62,839,387	L488F	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Fat2	T	G	11: 55,282,166	I2574L	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fryl	T	C	5: 73,073,904	D1610G	probably damaging	Het
Gm10330	T	A	12: 23,780,130	N17Y	probably damaging	Het
Gm4787	T	A	12: 81,377,465	R640*	probably null	Het
Gm8251	A	C	1: 44,057,979	C1320G	possibly damaging	Het
Hist1h2bl	A	T	13: 21,715,860	I95N	probably damaging	Het
Ift88	T	A	14: 57,438,242	S71T	probably benign	Het
Isoc2b	A	G	7: 4,849,358		probably benign	Het
Itgb2	G	T	10: 77,558,052	R442L	probably benign	Het
Lama5	A	T	2: 180,181,651	N2658K	possibly damaging	Het
Lemd3	A	T	10: 120,933,633	I598K	probably damaging	Het
Lrp2	A	T	2: 69,454,838	C3825*	probably null	Het
Mep1a	T	C	17: 43,477,146	D673G	probably damaging	Het
Mfn2	A	G	4: 147,894,578	V99A	probably damaging	Het
Mmadhc	A	G	2: 50,291,424	I78T	probably benign	Het
Mmp9	C	A	2: 164,950,992	P389T	possibly damaging	Het
Mvk	T	G	5: 114,452,438	S7A	probably damaging	Het
Nlrp1a	T	A	11: 71,124,251	T58S	probably benign	Het
Nlrp1c-ps	C	A	11: 71,258,013		noncoding transcript	Het
Nr1h3	A	G	2: 91,191,908	I125T	possibly damaging	Het
Olfr1089	A	T	2: 86,733,336	I92K	probably damaging	Het
Olfr443-ps1	C	T	6: 43,094,664		noncoding transcript	Het
Parn	A	G	16: 13,668,022	I3T	possibly damaging	Het
Parp8	A	G	13: 116,862,204		probably null	Het
Parva	T	C	7: 112,544,268		probably null	Het
Pwp2	A	C	10: 78,175,544	I672M	possibly damaging	Het
Sfswap	C	T	5: 129,539,746	T418I	probably benign	Het
Slc6a3	A	G	13: 73,560,959	Y334C	probably damaging	Het
Slc7a13	C	A	4: 19,839,267	T290K	probably benign	Het
Spry2	A	G	14: 105,893,278	L158P	probably damaging	Het
Usp25	A	G	16: 77,050,454	E150G	probably damaging	Het
Zfp747	A	G	7: 127,374,597	F134L	possibly damaging	Het
Zp3r	A	G	1: 130,596,781	F175S	probably benign	Het
Zscan22	C	A	7: 12,906,508	N67K	probably benign	Het

Other mutations in Met

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00533:Met	APN	6	17534937	unclassified	probably benign
IGL01066:Met	APN	6	17535105	critical splice donor site	probably null
IGL01344:Met	APN	6	17547032	missense	probably benign	0.44
IGL01413:Met	APN	6	17558896	splice site	probably benign
IGL01608:Met	APN	6	17558730	missense	probably damaging	1.00
IGL01613:Met	APN	6	17540577	missense	probably damaging	1.00
IGL01820:Met	APN	6	17534231	missense	possibly damaging	0.89
IGL01843:Met	APN	6	17491701	missense	probably damaging	1.00
IGL02014:Met	APN	6	17527257	splice site	probably benign
IGL02027:Met	APN	6	17563727	splice site	probably benign
IGL02243:Met	APN	6	17549094	missense	probably damaging	1.00
IGL02373:Met	APN	6	17491529	missense	probably damaging	1.00
IGL02616:Met	APN	6	17553347	missense	probably damaging	1.00
IGL02702:Met	APN	6	17534143	missense	possibly damaging	0.92
IGL02704:Met	APN	6	17491257	missense	possibly damaging	0.62
IGL02714:Met	APN	6	17491852	nonsense	probably null
IGL02936:Met	APN	6	17553397	missense	probably damaging	1.00
IGL02943:Met	APN	6	17535929	missense	possibly damaging	0.84
IGL03057:Met	APN	6	17558766	missense	probably damaging	1.00
IGL03124:Met	APN	6	17492078	missense	probably benign	0.27
IGL03171:Met	APN	6	17562273	splice site	probably benign
IGL03266:Met	APN	6	17540538	missense	possibly damaging	0.61
IGL03285:Met	APN	6	17553337	missense	probably damaging	0.98
R0453:Met	UTSW	6	17534198	missense	possibly damaging	0.88
R0543:Met	UTSW	6	17491970	missense	probably damaging	1.00
R0601:Met	UTSW	6	17555632	splice site	probably null
R0652:Met	UTSW	6	17491710	missense	probably benign	0.00
R0941:Met	UTSW	6	17491394	missense	probably damaging	1.00
R1142:Met	UTSW	6	17527183	nonsense	probably null
R1553:Met	UTSW	6	17491461	missense	probably benign	0.01
R1569:Met	UTSW	6	17531504	nonsense	probably null
R1744:Met	UTSW	6	17540646	missense	possibly damaging	0.47
R2224:Met	UTSW	6	17563722	splice site	probably null
R2308:Met	UTSW	6	17491742	missense	probably benign	0.00
R2369:Met	UTSW	6	17531528	missense	probably benign	0.04
R2393:Met	UTSW	6	17534198	missense	probably damaging	0.99
R2419:Met	UTSW	6	17535830	splice site	probably benign
R2483:Met	UTSW	6	17549086	missense	probably damaging	1.00
R2511:Met	UTSW	6	17491967	missense	probably damaging	1.00
R3622:Met	UTSW	6	17549086	missense	probably damaging	1.00
R3623:Met	UTSW	6	17549086	missense	probably damaging	1.00
R3624:Met	UTSW	6	17549086	missense	probably damaging	1.00
R4050:Met	UTSW	6	17533984	missense	probably benign
R4051:Met	UTSW	6	17548729	missense	possibly damaging	0.86
R4159:Met	UTSW	6	17562272	splice site	probably null
R4208:Met	UTSW	6	17548729	missense	possibly damaging	0.86
R4622:Met	UTSW	6	17513384	missense	probably benign	0.19
R4672:Met	UTSW	6	17571804	missense	probably benign	0.33
R4737:Met	UTSW	6	17491541	missense	probably damaging	1.00
R4738:Met	UTSW	6	17491541	missense	probably damaging	1.00
R4834:Met	UTSW	6	17491413	missense	probably damaging	0.97
R4846:Met	UTSW	6	17491929	missense	probably damaging	0.99
R4855:Met	UTSW	6	17558797	missense	probably damaging	1.00
R4878:Met	UTSW	6	17549059	missense	probably damaging	1.00
R4902:Met	UTSW	6	17546996	missense	probably damaging	1.00
R5208:Met	UTSW	6	17526423	nonsense	probably null
R5415:Met	UTSW	6	17527085	missense	probably benign	0.01
R5556:Met	UTSW	6	17534176	missense	probably benign	0.04
R5590:Met	UTSW	6	17548782	missense	probably benign	0.00
R5683:Met	UTSW	6	17571744	missense	probably damaging	1.00
R5872:Met	UTSW	6	17562198	missense	probably damaging	1.00
R5891:Met	UTSW	6	17491539	missense	probably benign	0.02
R5895:Met	UTSW	6	17531582	missense	probably benign	0.02
R6063:Met	UTSW	6	17491968	missense	probably damaging	1.00
R6262:Met	UTSW	6	17553404	missense	probably benign	0.00
R6362:Met	UTSW	6	17558733	missense	probably damaging	1.00
R6747:Met	UTSW	6	17571467	missense	probably damaging	1.00
R6966:Met	UTSW	6	17531532	missense	possibly damaging	0.65
R6989:Met	UTSW	6	17535928	missense	possibly damaging	0.67
R6989:Met	UTSW	6	17535929	missense	probably damaging	1.00
R7017:Met	UTSW	6	17491287	nonsense	probably null
R7037:Met	UTSW	6	17547128	intron	probably benign
R7141:Met	UTSW	6	17527155	missense	probably benign	0.01
R7242:Met	UTSW	6	17491317	missense	probably damaging	1.00
R7282:Met	UTSW	6	17547012	nonsense	probably null
R7624:Met	UTSW	6	17558835	missense	probably damaging	1.00
R7770:Met	UTSW	6	17491407	missense	possibly damaging	0.79
R7797:Met	UTSW	6	17533953	missense	probably damaging	1.00
R8082:Met	UTSW	6	17492313	missense	probably damaging	0.98
R8109:Met	UTSW	6	17562237	missense	probably damaging	1.00
R8162:Met	UTSW	6	17547062	missense	probably damaging	0.98
R8315:Met	UTSW	6	17533957	missense	probably damaging	0.99
R8325:Met	UTSW	6	17571672	missense	probably damaging	1.00
R8348:Met	UTSW	6	17571800	missense	probably benign	0.00
R8354:Met	UTSW	6	17491769	missense	probably damaging	1.00
R8448:Met	UTSW	6	17571800	missense	probably benign	0.00
R8454:Met	UTSW	6	17491769	missense	probably damaging	1.00
R8465:Met	UTSW	6	17571810	missense	probably benign	0.04
R8479:Met	UTSW	6	17491747	splice site	probably null
R8737:Met	UTSW	6	17540511	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGATATCGAAGCTGGAGGAGTC -3'
(R):5'- CCGACAAGGTAAACAATCTGGG -3'

Sequencing Primer
(F):5'- AAGCTGGAGGAGTCATGCTTCC -3'
(R):5'- CAAGGTAAACAATCTGGGTGTTCC -3'

Posted On

2016-08-04