Incidental Mutation 'R5355:Isoc2b'
ID424038
Institutional Source Beutler Lab
Gene Symbol Isoc2b
Ensembl Gene ENSMUSG00000052605
Gene Nameisochorismatase domain containing 2b
Synonyms
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4844959-4870258 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 4849358 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064547] [ENSMUST00000066041] [ENSMUST00000119433] [ENSMUST00000208816]
Predicted Effect probably benign
Transcript: ENSMUST00000064547
SMART Domains Protein: ENSMUSP00000066859
Gene: ENSMUSG00000052605

DomainStartEndE-ValueType
Pfam:Isochorismatase 16 163 2.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066041
SMART Domains Protein: ENSMUSP00000064886
Gene: ENSMUSG00000053550

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 61 N/A INTRINSIC
Pfam:Shisa 82 156 1.7e-24 PFAM
low complexity region 449 462 N/A INTRINSIC
low complexity region 466 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119433
SMART Domains Protein: ENSMUSP00000112423
Gene: ENSMUSG00000053550

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 61 N/A INTRINSIC
Pfam:Shisa 81 150 5.8e-21 PFAM
low complexity region 432 445 N/A INTRINSIC
low complexity region 449 489 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000133406
AA Change: F162S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208173
Predicted Effect probably benign
Transcript: ENSMUST00000208816
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Isoc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Isoc2b APN 7 4850764 missense probably damaging 1.00
R2112:Isoc2b UTSW 7 4849475 missense probably damaging 1.00
R2130:Isoc2b UTSW 7 4851439 missense probably damaging 0.96
R2193:Isoc2b UTSW 7 4850824 missense probably benign 0.00
R4411:Isoc2b UTSW 7 4849434 intron probably benign
R5497:Isoc2b UTSW 7 4850783 missense probably benign 0.02
R5831:Isoc2b UTSW 7 4851024 missense probably null 0.38
R5907:Isoc2b UTSW 7 4849578 splice site probably null
R6542:Isoc2b UTSW 7 4851455 missense probably damaging 1.00
R6766:Isoc2b UTSW 7 4851062 missense probably damaging 1.00
R6891:Isoc2b UTSW 7 4851488 missense probably damaging 0.99
R7475:Isoc2b UTSW 7 4851085 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACCCAGATTTGAATTTGACTCCTAG -3'
(R):5'- ACAATGTAGACACTCTGCCTCTC -3'

Sequencing Primer
(F):5'- AGATTTGAATTTGACTCCTAGTTCCC -3'
(R):5'- TCCCTCCGCAGTGAGATGAAC -3'
Posted On2016-08-04