Mutagenetix > Incidental Mutation

Incidental Mutation 'R5355:Adam12'

424044

Institutional Source

Beutler Lab

Gene Symbol

Adam12

Ensembl Gene

ENSMUSG00000054555

Gene Name

a disintegrin and metallopeptidase domain 12 (meltrin alpha)

Synonyms

Mltna, ADAM12

MMRRC Submission

042934-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.400) question?

Stock #

R5355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133883199-134232146 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 133887942 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 582 (*582W)

Ref Sequence

ENSEMBL: ENSMUSP00000114874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000138363]

AlphaFold

Q61824

Predicted Effect

probably null
Transcript: ENSMUST00000067680
AA Change: *904W

SMART Domains

Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: *904W

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	165	1.1e-27	PFAM
Pfam:Reprolysin_5	210	392	2.1e-24	PFAM
Pfam:Reprolysin_4	210	408	3.8e-16	PFAM
Pfam:Reprolysin	212	414	1.4e-74	PFAM
Pfam:Reprolysin_2	232	404	6e-18	PFAM
Pfam:Reprolysin_3	236	359	1.3e-16	PFAM
DISIN	431	506	4.29e-42	SMART
ACR	507	650	1.75e-67	SMART
transmembrane domain	705	727	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000138363
AA Change: *582W

SMART Domains

Protein: ENSMUSP00000114874
Gene: ENSMUSG00000054555
AA Change: *582W

Domain	Start	End	E-Value	Type
Pfam:Reprolysin	4	92	4.5e-24	PFAM
Pfam:Reprolysin_2	6	82	2.1e-11	PFAM
Pfam:Reprolysin_5	9	70	2.8e-11	PFAM
Pfam:Reprolysin_4	11	87	8.9e-8	PFAM
DISIN	109	184	4.29e-42	SMART
ACR	185	328	1.75e-67	SMART
transmembrane domain	383	405	N/A	INTRINSIC

Meta Mutation Damage Score

0.8516

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

94% (50/53)

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	C	5: 8,726,873	L857P	probably damaging	Het
Adra1d	A	G	2: 131,561,087	V361A	probably damaging	Het
Ank2	A	G	3: 126,944,049		probably benign	Het
Atxn10	T	A	15: 85,462,314	N424K	probably damaging	Het
C8b	A	G	4: 104,780,663	T111A	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdr2l	T	C	11: 115,393,570	V244A	possibly damaging	Het
Col11a2	A	G	17: 34,051,801	M468V	probably benign	Het
Col4a2	G	A	8: 11,445,984	R1535H	probably damaging	Het
Cryab	A	T	9: 50,753,451	S59C	probably damaging	Het
Cuzd1	G	A	7: 131,316,124	T249I	probably damaging	Het
Disp2	G	A	2: 118,786,911	V129M	probably benign	Het
Dlg2	G	T	7: 91,449,803	R31L	probably benign	Het
Dthd1	A	C	5: 62,839,387	L488F	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Fat2	T	G	11: 55,282,166	I2574L	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fryl	T	C	5: 73,073,904	D1610G	probably damaging	Het
Gm10330	T	A	12: 23,780,130	N17Y	probably damaging	Het
Gm4787	T	A	12: 81,377,465	R640*	probably null	Het
Gm8251	A	C	1: 44,057,979	C1320G	possibly damaging	Het
Hist1h2bl	A	T	13: 21,715,860	I95N	probably damaging	Het
Ift88	T	A	14: 57,438,242	S71T	probably benign	Het
Isoc2b	A	G	7: 4,849,358		probably benign	Het
Itgb2	G	T	10: 77,558,052	R442L	probably benign	Het
Lama5	A	T	2: 180,181,651	N2658K	possibly damaging	Het
Lemd3	A	T	10: 120,933,633	I598K	probably damaging	Het
Lrp2	A	T	2: 69,454,838	C3825*	probably null	Het
Mep1a	T	C	17: 43,477,146	D673G	probably damaging	Het
Met	A	G	6: 17,491,362	Y41C	probably damaging	Het
Mfn2	A	G	4: 147,894,578	V99A	probably damaging	Het
Mmadhc	A	G	2: 50,291,424	I78T	probably benign	Het
Mmp9	C	A	2: 164,950,992	P389T	possibly damaging	Het
Mvk	T	G	5: 114,452,438	S7A	probably damaging	Het
Nlrp1a	T	A	11: 71,124,251	T58S	probably benign	Het
Nlrp1c-ps	C	A	11: 71,258,013		noncoding transcript	Het
Nr1h3	A	G	2: 91,191,908	I125T	possibly damaging	Het
Olfr1089	A	T	2: 86,733,336	I92K	probably damaging	Het
Olfr443-ps1	C	T	6: 43,094,664		noncoding transcript	Het
Parn	A	G	16: 13,668,022	I3T	possibly damaging	Het
Parp8	A	G	13: 116,862,204		probably null	Het
Parva	T	C	7: 112,544,268		probably null	Het
Pwp2	A	C	10: 78,175,544	I672M	possibly damaging	Het
Sfswap	C	T	5: 129,539,746	T418I	probably benign	Het
Slc6a3	A	G	13: 73,560,959	Y334C	probably damaging	Het
Slc7a13	C	A	4: 19,839,267	T290K	probably benign	Het
Spry2	A	G	14: 105,893,278	L158P	probably damaging	Het
Usp25	A	G	16: 77,050,454	E150G	probably damaging	Het
Zfp747	A	G	7: 127,374,597	F134L	possibly damaging	Het
Zp3r	A	G	1: 130,596,781	F175S	probably benign	Het
Zscan22	C	A	7: 12,906,508	N67K	probably benign	Het

Other mutations in Adam12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Adam12	APN	7	133909881	missense	possibly damaging	0.51
IGL01403:Adam12	APN	7	133919610	missense	probably benign	0.00
IGL01482:Adam12	APN	7	133967848	missense	probably damaging	1.00
IGL01922:Adam12	APN	7	133937472	nonsense	probably null
IGL02397:Adam12	APN	7	133909819	splice site	probably benign
IGL03401:Adam12	APN	7	133916463	missense	probably damaging	1.00
R0122:Adam12	UTSW	7	134012348	missense	probably benign	0.45
R0200:Adam12	UTSW	7	133974416	splice site	probably null
R0463:Adam12	UTSW	7	133974416	splice site	probably null
R0927:Adam12	UTSW	7	133998230	missense	probably damaging	1.00
R1258:Adam12	UTSW	7	133937447	missense	probably damaging	1.00
R1440:Adam12	UTSW	7	133931814	missense	probably benign	0.03
R1483:Adam12	UTSW	7	133930025	missense	probably benign	0.41
R1692:Adam12	UTSW	7	133887944	makesense	probably null
R1797:Adam12	UTSW	7	133967861	missense	probably benign	0.03
R2134:Adam12	UTSW	7	134012288	nonsense	probably null
R2230:Adam12	UTSW	7	133919618	missense	probably damaging	1.00
R2350:Adam12	UTSW	7	133919524	missense	probably damaging	1.00
R2944:Adam12	UTSW	7	133975507	missense	probably null	0.02
R3688:Adam12	UTSW	7	133964796	nonsense	probably null
R3747:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R3749:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R3750:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R4028:Adam12	UTSW	7	133929996	missense	probably damaging	1.00
R4130:Adam12	UTSW	7	133912924	missense	probably damaging	1.00
R4131:Adam12	UTSW	7	133912924	missense	probably damaging	1.00
R4346:Adam12	UTSW	7	133981535	missense	possibly damaging	0.82
R4701:Adam12	UTSW	7	133916462	missense	possibly damaging	0.64
R4887:Adam12	UTSW	7	134172821	missense	possibly damaging	0.74
R5468:Adam12	UTSW	7	133975473	missense	probably damaging	1.00
R5486:Adam12	UTSW	7	133907672	missense	possibly damaging	0.75
R5990:Adam12	UTSW	7	133931736	missense	probably damaging	1.00
R6504:Adam12	UTSW	7	133929984	missense	probably damaging	1.00
R6783:Adam12	UTSW	7	133974397	missense	probably damaging	1.00
R7117:Adam12	UTSW	7	133916462	missense	probably benign	0.00
R7263:Adam12	UTSW	7	133919511	missense	possibly damaging	0.68
R7749:Adam12	UTSW	7	134224813	missense	unknown
R7820:Adam12	UTSW	7	133998188	missense	probably benign	0.00
R7880:Adam12	UTSW	7	133909962	missense	possibly damaging	0.94
R7891:Adam12	UTSW	7	133998232	missense	probably benign	0.00
R8114:Adam12	UTSW	7	133967888	missense	probably damaging	1.00
R8160:Adam12	UTSW	7	133968041	splice site	probably null
R8683:Adam12	UTSW	7	133890200	missense	possibly damaging	0.49
R9236:Adam12	UTSW	7	134012293	missense	probably benign	0.03
R9277:Adam12	UTSW	7	133919832	missense	probably benign	0.00
R9480:Adam12	UTSW	7	134134741	missense	probably damaging	0.98
R9515:Adam12	UTSW	7	133907644	missense	probably benign	0.03
R9599:Adam12	UTSW	7	133964725	missense	probably damaging	0.99
X0057:Adam12	UTSW	7	134012315	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGCGCAGTAATAGACACTCTG -3'
(R):5'- TAAGCTGGGAGACACACCAG -3'

Sequencing Primer
(F):5'- CTTACAAGTTCCTGAGCAAGTAC -3'
(R):5'- ACACCAGTGTGCAGGAGCTG -3'

Posted On

2016-08-04