Incidental Mutation 'R0488:Rimklb'
ID42405
Institutional Source Beutler Lab
Gene Symbol Rimklb
Ensembl Gene ENSMUSG00000040649
Gene Nameribosomal modification protein rimK-like family member B
Synonyms4931417E21Rik, NAAGS, 4933426K21Rik
MMRRC Submission 038687-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0488 (G1)
Quality Score186
Status Validated
Chromosome6
Chromosomal Location122447296-122498761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122460975 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 103 (T103I)
Ref Sequence ENSEMBL: ENSMUSP00000144770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068242] [ENSMUST00000146274] [ENSMUST00000204731] [ENSMUST00000205114]
Predicted Effect probably benign
Transcript: ENSMUST00000068242
AA Change: T160I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000064467
Gene: ENSMUSG00000040649
AA Change: T160I

DomainStartEndE-ValueType
low complexity region 71 83 N/A INTRINSIC
Pfam:ATP-grasp_4 111 283 7.4e-13 PFAM
Pfam:ATP-grasp_3 112 283 2.6e-9 PFAM
Pfam:RimK 112 303 6.9e-45 PFAM
Pfam:GSH-S_ATP 131 269 5e-14 PFAM
low complexity region 337 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143701
Predicted Effect probably benign
Transcript: ENSMUST00000146274
AA Change: T103I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138104
Gene: ENSMUSG00000040649
AA Change: T103I

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Pfam:ATP-grasp_4 54 225 6.7e-13 PFAM
Pfam:ATP-grasp_3 55 226 1.1e-9 PFAM
Pfam:RimK 55 242 6.7e-43 PFAM
Pfam:GSH-S_ATP 72 212 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204731
AA Change: T103I

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144770
Gene: ENSMUSG00000040649
AA Change: T103I

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Pfam:ATP-grasp_4 54 226 5e-13 PFAM
Pfam:ATP-grasp_3 55 226 1.7e-9 PFAM
Pfam:RimK 55 246 4.5e-45 PFAM
Pfam:GSH-S_ATP 74 212 3.6e-14 PFAM
low complexity region 280 297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205114
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T G 11: 46,138,930 L734R probably damaging Het
Adgrf1 T C 17: 43,310,411 I513T probably damaging Het
Adgrl2 A G 3: 148,846,905 V654A probably damaging Het
Agl A T 3: 116,754,962 Y1249* probably null Het
Ankar T A 1: 72,658,732 Q996H probably damaging Het
Aqp12 T C 1: 93,008,656 Y235H probably damaging Het
Arsb T C 13: 93,940,505 V460A probably benign Het
Baiap3 A G 17: 25,248,470 probably null Het
Cd44 T C 2: 102,834,219 probably benign Het
Clec4b1 T A 6: 123,071,482 I192N probably damaging Het
Cps1 A C 1: 67,148,808 probably benign Het
Dab2 T C 15: 6,424,654 L215S probably damaging Het
E2f4 G A 8: 105,298,539 V84I probably damaging Het
Edem2 T C 2: 155,716,123 T197A probably damaging Het
Eno2 T A 6: 124,763,874 M121L probably benign Het
Ephb1 A G 9: 101,964,008 V757A probably damaging Het
Etv5 T A 16: 22,412,945 I106F probably damaging Het
Foxj3 T A 4: 119,619,990 Y298* probably null Het
Gm12185 A G 11: 48,907,839 L609S probably damaging Het
Gm5884 T C 6: 128,646,068 noncoding transcript Het
Havcr1 A G 11: 46,752,571 Y106C probably damaging Het
Jmjd1c A G 10: 67,240,727 N2110S probably damaging Het
Kif2b T C 11: 91,576,972 K162E probably benign Het
Micu2 T C 14: 57,932,242 Y217C probably benign Het
Mink1 G T 11: 70,597,204 G32C probably damaging Het
Mnat1 T A 12: 73,170,639 N96K probably damaging Het
Mpp2 G T 11: 102,061,601 R349S possibly damaging Het
Mrpl13 T A 15: 55,539,148 I59F probably benign Het
Mybl2 T C 2: 163,072,614 probably benign Het
Otogl T C 10: 107,803,605 E1382G probably benign Het
Pclo A G 5: 14,669,299 E1150G unknown Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pla2g4a G A 1: 149,871,445 T322M probably damaging Het
Pramef6 A T 4: 143,895,403 Y461N probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptprg A T 14: 12,220,653 D455V probably damaging Het
Ptprt T C 2: 161,553,825 T1162A probably damaging Het
Rad51ap1 T C 6: 126,934,760 N55D possibly damaging Het
Rc3h2 T C 2: 37,389,588 E543G probably damaging Het
Rsg1 A G 4: 141,214,401 D14G probably benign Het
Samd4b T C 7: 28,414,237 Y101C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tubgcp5 T A 7: 55,829,338 S979T probably damaging Het
Vmn2r93 G A 17: 18,326,049 E728K probably damaging Het
Wdr17 T C 8: 54,693,052 probably benign Het
Wdr90 T C 17: 25,848,617 Y1457C probably damaging Het
Wsb1 T C 11: 79,244,500 D225G probably damaging Het
Xirp2 T C 2: 67,514,821 S2469P possibly damaging Het
Zeb1 T A 18: 5,772,455 C915S probably damaging Het
Znfx1 C A 2: 167,042,563 R923L possibly damaging Het
Other mutations in Rimklb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Rimklb APN 6 122456631 missense possibly damaging 0.58
IGL01674:Rimklb APN 6 122459170 missense probably damaging 0.98
IGL03390:Rimklb APN 6 122456321 missense possibly damaging 0.71
IGL03401:Rimklb APN 6 122464118 missense probably damaging 1.00
R0234:Rimklb UTSW 6 122456333 missense probably benign 0.00
R0234:Rimklb UTSW 6 122456333 missense probably benign 0.00
R0479:Rimklb UTSW 6 122464216 splice site probably benign
R1843:Rimklb UTSW 6 122464009 missense probably damaging 1.00
R2887:Rimklb UTSW 6 122472698 missense probably benign
R4674:Rimklb UTSW 6 122456283 nonsense probably null
R4746:Rimklb UTSW 6 122472632 nonsense probably null
R4755:Rimklb UTSW 6 122456406 missense probably damaging 1.00
R4888:Rimklb UTSW 6 122464092 unclassified probably null
R6174:Rimklb UTSW 6 122456412 missense probably damaging 0.99
R7041:Rimklb UTSW 6 122459217 nonsense probably null
R7170:Rimklb UTSW 6 122452738 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGACGTGACATTTCTCCACATCC -3'
(R):5'- CCTTGTGTTGTGCTTAAAAGTGGTTCCA -3'

Sequencing Primer
(F):5'- TTTTCCAACTAGACAACCTGAGGG -3'
(R):5'- CAGGTGGCCACGAAAACTTT -3'
Posted On2013-05-23