Incidental Mutation 'R5355:Cdr2l'
ID424054
Institutional Source Beutler Lab
Gene Symbol Cdr2l
Ensembl Gene ENSMUSG00000050910
Gene Namecerebellar degeneration-related protein 2-like
Synonyms
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115381916-115396132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115393570 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 244 (V244A)
Ref Sequence ENSEMBL: ENSMUSP00000052096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053288
AA Change: V244A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052096
Gene: ENSMUSG00000050910
AA Change: V244A

DomainStartEndE-ValueType
coiled coil region 31 143 N/A INTRINSIC
coiled coil region 188 267 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Cdr2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Cdr2l APN 11 115392738 missense probably damaging 0.99
IGL01326:Cdr2l APN 11 115390970 missense probably benign 0.04
IGL01411:Cdr2l APN 11 115382366 missense probably damaging 0.99
IGL01459:Cdr2l APN 11 115390552 missense probably damaging 1.00
IGL02971:Cdr2l APN 11 115390900 missense probably damaging 1.00
R0135:Cdr2l UTSW 11 115393671 missense probably damaging 1.00
R1181:Cdr2l UTSW 11 115394179 missense probably damaging 1.00
R1598:Cdr2l UTSW 11 115393377 missense probably damaging 0.99
R1612:Cdr2l UTSW 11 115393406 missense probably benign 0.01
R1919:Cdr2l UTSW 11 115392777 missense probably damaging 1.00
R2090:Cdr2l UTSW 11 115391001 missense probably damaging 1.00
R2286:Cdr2l UTSW 11 115392800 frame shift probably null
R4938:Cdr2l UTSW 11 115393825 missense possibly damaging 0.86
R5114:Cdr2l UTSW 11 115393360 missense probably damaging 1.00
R6783:Cdr2l UTSW 11 115393669 missense possibly damaging 0.56
R7156:Cdr2l UTSW 11 115390966 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GCAGATGTGAGGATGCCTTC -3'
(R):5'- CACCATCCTGGGCATTAGAGTC -3'

Sequencing Primer
(F):5'- GATGCCTTCCGCCTACACAG -3'
(R):5'- GGGCATTAGAGTCATCTCCACTG -3'
Posted On2016-08-04