Incidental Mutation 'R5355:Gm4787'
ID424056
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Namepredicted gene 4787
Synonyms
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81376991-81379464 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 81377465 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 640 (R640*)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably null
Transcript: ENSMUST00000062182
AA Change: R640*
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: R640*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087222
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
R8022:Gm4787 UTSW 12 81377720 missense possibly damaging 0.94
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAGGGTTAGTTATAGGGCCAC -3'
(R):5'- TGTCCCATGTCAAAAGGAGG -3'

Sequencing Primer
(F):5'- ATAGGGCCACTGTTTACACTAC -3'
(R):5'- CTCCACTGTGATGGTGTCAAGC -3'
Posted On2016-08-04