Incidental Mutation 'R5355:Slc6a3'
ID424058
Institutional Source Beutler Lab
Gene Symbol Slc6a3
Ensembl Gene ENSMUSG00000021609
Gene Namesolute carrier family 6 (neurotransmitter transporter, dopamine), member 3
SynonymsDat1, DAT
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73536747-73578672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73560959 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 334 (Y334C)
Ref Sequence ENSEMBL: ENSMUSP00000022100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022100]
Predicted Effect probably damaging
Transcript: ENSMUST00000022100
AA Change: Y334C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: Y334C

DomainStartEndE-ValueType
Pfam:SNF 60 582 8.1e-237 PFAM
Meta Mutation Damage Score 0.9507 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Slc6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc6a3 APN 13 73544741 missense probably damaging 1.00
IGL01524:Slc6a3 APN 13 73538549 missense probably benign 0.01
IGL02015:Slc6a3 APN 13 73544714 missense possibly damaging 0.60
IGL03008:Slc6a3 APN 13 73558285 critical splice donor site probably null
IGL03029:Slc6a3 APN 13 73538697 missense probably damaging 1.00
IGL03064:Slc6a3 APN 13 73571466 missense probably damaging 0.99
IGL03272:Slc6a3 APN 13 73540929 missense probably damaging 0.98
IGL03294:Slc6a3 APN 13 73557181 critical splice donor site probably null
IGL03345:Slc6a3 APN 13 73571514 missense probably benign
IGL03410:Slc6a3 APN 13 73538657 missense probably benign 0.03
disney UTSW 13 73544884 missense probably benign
dopey UTSW 13 73560959 missense probably damaging 1.00
Dopey2 UTSW 13 73544817 missense probably damaging 1.00
Stiff UTSW 13 73557050 missense possibly damaging 0.85
PIT4382001:Slc6a3 UTSW 13 73571523 missense probably benign 0.35
R0024:Slc6a3 UTSW 13 73540837 splice site probably benign
R0125:Slc6a3 UTSW 13 73569979 splice site probably benign
R0180:Slc6a3 UTSW 13 73562336 missense probably damaging 1.00
R0288:Slc6a3 UTSW 13 73560928 missense probably damaging 1.00
R0322:Slc6a3 UTSW 13 73560926 missense possibly damaging 0.61
R0349:Slc6a3 UTSW 13 73567557 missense probably damaging 1.00
R0411:Slc6a3 UTSW 13 73557050 missense possibly damaging 0.85
R0594:Slc6a3 UTSW 13 73538642 missense probably damaging 0.99
R0680:Slc6a3 UTSW 13 73538727 missense probably damaging 1.00
R1099:Slc6a3 UTSW 13 73567641 missense probably benign 0.21
R1109:Slc6a3 UTSW 13 73557080 missense probably benign 0.00
R1791:Slc6a3 UTSW 13 73566292 missense possibly damaging 0.82
R3916:Slc6a3 UTSW 13 73562308 missense probably benign 0.00
R4279:Slc6a3 UTSW 13 73544834 missense possibly damaging 0.90
R4368:Slc6a3 UTSW 13 73560912 nonsense probably null
R4520:Slc6a3 UTSW 13 73540856 missense possibly damaging 0.95
R4666:Slc6a3 UTSW 13 73538581 missense possibly damaging 0.47
R4675:Slc6a3 UTSW 13 73544817 missense probably damaging 1.00
R4716:Slc6a3 UTSW 13 73557076 missense probably benign 0.04
R5243:Slc6a3 UTSW 13 73571451 missense possibly damaging 0.61
R5681:Slc6a3 UTSW 13 73538735 missense probably damaging 0.99
R5737:Slc6a3 UTSW 13 73544804 missense probably damaging 0.99
R6142:Slc6a3 UTSW 13 73544783 missense probably benign 0.00
R6471:Slc6a3 UTSW 13 73544884 missense probably benign
R7168:Slc6a3 UTSW 13 73571472 missense probably benign 0.00
R7403:Slc6a3 UTSW 13 73562427 critical splice donor site probably null
R8282:Slc6a3 UTSW 13 73557081 missense probably benign 0.01
R8359:Slc6a3 UTSW 13 73544883 missense probably benign
R8446:Slc6a3 UTSW 13 73571555 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGACAGCTCCCATTCTCGAC -3'
(R):5'- TTCAGTGCAAAGCCAAGCC -3'

Sequencing Primer
(F):5'- ACCTCGGGTGGAACTAACTC -3'
(R):5'- ACTTAGGTTGTAGCATGAGACCC -3'
Posted On2016-08-04