Incidental Mutation 'R5355:Parp8'
ID424059
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Namepoly (ADP-ribose) polymerase family, member 8
SynonymsD13Ertd275e, 2810430O08Rik
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location116854820-117025537 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 116862204 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000226107]
Predicted Effect probably null
Transcript: ENSMUST00000022239
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000223949
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 116927323 missense probably damaging 1.00
IGL01346:Parp8 APN 13 116895064 missense possibly damaging 0.72
IGL01793:Parp8 APN 13 116910879 missense probably damaging 1.00
IGL01926:Parp8 APN 13 116862302 splice site probably benign
IGL01958:Parp8 APN 13 116876572 missense probably benign 0.14
IGL02131:Parp8 APN 13 116910873 missense probably benign 0.08
IGL02398:Parp8 APN 13 116910863 critical splice donor site probably null
IGL02496:Parp8 APN 13 116862302 splice site probably benign
IGL03135:Parp8 APN 13 116910942 missense probably benign 0.41
IGL03143:Parp8 APN 13 116910961 splice site probably benign
IGL03201:Parp8 APN 13 116863069 splice site probably benign
blondi UTSW 13 116893041 missense possibly damaging 0.77
Heidi UTSW 13 116862204 splice site probably null
R0362:Parp8 UTSW 13 116924968 nonsense probably null
R0699:Parp8 UTSW 13 116922584 missense probably benign 0.01
R1445:Parp8 UTSW 13 117025350 utr 5 prime probably null
R1676:Parp8 UTSW 13 116877528 missense probably damaging 0.99
R1977:Parp8 UTSW 13 116910913 missense probably damaging 0.96
R2019:Parp8 UTSW 13 116868432 splice site probably benign
R2049:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2142:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2474:Parp8 UTSW 13 116893041 missense possibly damaging 0.77
R2566:Parp8 UTSW 13 116895687 missense possibly damaging 0.78
R3863:Parp8 UTSW 13 116894767 missense probably benign 0.01
R4126:Parp8 UTSW 13 116868469 missense possibly damaging 0.94
R4518:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4519:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4767:Parp8 UTSW 13 116868536 missense probably damaging 0.99
R5633:Parp8 UTSW 13 116876580 missense probably damaging 1.00
R5942:Parp8 UTSW 13 116869433 missense probably benign 0.12
R5978:Parp8 UTSW 13 116895732 missense probably benign 0.01
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6753:Parp8 UTSW 13 116895115 missense possibly damaging 0.91
R7016:Parp8 UTSW 13 116895091 missense probably damaging 1.00
R7139:Parp8 UTSW 13 117025266 missense probably benign 0.21
R7305:Parp8 UTSW 13 116894925 missense possibly damaging 0.95
R7314:Parp8 UTSW 13 116868460 missense probably benign 0.01
R7360:Parp8 UTSW 13 116895771 missense probably benign 0.02
R7526:Parp8 UTSW 13 116894805 missense probably damaging 1.00
R8078:Parp8 UTSW 13 116924983 missense probably damaging 1.00
R8108:Parp8 UTSW 13 116867073 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGTTCAACCATCACTGACCTC -3'
(R):5'- TTTCCTTAATGGCAAAGTGGC -3'

Sequencing Primer
(F):5'- TGACCTCAATAAGCATACTCAGATG -3'
(R):5'- TCCTTTGGACAGATTTCAGAGAG -3'
Posted On2016-08-04