Incidental Mutation 'R5355:Atxn10'
ID424062
Institutional Source Beutler Lab
Gene Symbol Atxn10
Ensembl Gene ENSMUSG00000016541
Gene Nameataxin 10
SynonymsTEG-169, Sca10, E46, Tex169
MMRRC Submission 042934-MU
Accession Numbers

Genbank: NM_016843: MGI: 1859293

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85336245-85463212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85462314 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 424 (N424K)
Ref Sequence ENSEMBL: ENSMUSP00000132450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163242]
Predicted Effect probably damaging
Transcript: ENSMUST00000163242
AA Change: N424K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132450
Gene: ENSMUSG00000016541
AA Change: N424K

DomainStartEndE-ValueType
Pfam:Atx10homo_assoc 370 467 4.7e-38 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die at early postimplantation stages. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Gene trapped(20)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Atxn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Atxn10 APN 15 85336465 start codon destroyed probably benign 0.33
IGL01020:Atxn10 APN 15 85375422 splice site probably null
IGL01380:Atxn10 APN 15 85376695 nonsense probably null
IGL01408:Atxn10 APN 15 85376695 nonsense probably null
3-1:Atxn10 UTSW 15 85438094 splice site probably benign
R0190:Atxn10 UTSW 15 85336529 missense possibly damaging 0.84
R0319:Atxn10 UTSW 15 85365282 missense probably damaging 1.00
R1437:Atxn10 UTSW 15 85359474 missense possibly damaging 0.47
R1746:Atxn10 UTSW 15 85376663 missense probably damaging 1.00
R2050:Atxn10 UTSW 15 85365312 missense probably benign 0.37
R3055:Atxn10 UTSW 15 85387005 missense probably benign 0.03
R4559:Atxn10 UTSW 15 85438120 missense possibly damaging 0.81
R4786:Atxn10 UTSW 15 85387143 missense probably benign 0.03
R4799:Atxn10 UTSW 15 85376708 splice site probably null
R4831:Atxn10 UTSW 15 85387059 missense probably benign 0.01
R5323:Atxn10 UTSW 15 85391743 missense probably benign 0.00
R5335:Atxn10 UTSW 15 85336584 splice site probably null
R5768:Atxn10 UTSW 15 85393420 missense probably benign 0.01
R6260:Atxn10 UTSW 15 85462411 missense probably benign 0.38
R6277:Atxn10 UTSW 15 85391692 missense probably benign 0.05
R6370:Atxn10 UTSW 15 85393385 missense probably damaging 1.00
R6645:Atxn10 UTSW 15 85376703 critical splice donor site probably null
R6957:Atxn10 UTSW 15 85336498 missense probably damaging 1.00
R7859:Atxn10 UTSW 15 85462325 missense probably benign 0.01
R7942:Atxn10 UTSW 15 85462325 missense probably benign 0.01
R8031:Atxn10 UTSW 15 85393393 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGGGTTTCTCATTGAGTGC -3'
(R):5'- CCAAGTCACAGAGATGCAGG -3'

Sequencing Primer
(F):5'- CTCATTGAGTGCATATGTATTCTCC -3'
(R):5'- CTGAGGACAGCTTACAGAGGGTAC -3'
Posted On2016-08-04