Mutagenetix > Incidental Mutation

Incidental Mutation 'R5355:Parn'

424063

Institutional Source

Beutler Lab

Gene Symbol

Parn

Ensembl Gene

ENSMUSG00000022685

Gene Name

poly(A)-specific ribonuclease (deadenylation nuclease)

Synonyms

DAN, 1200003I18Rik

MMRRC Submission

042934-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R5355 (G1)

Quality Score

156

Status

Validated

Chromosome

Chromosomal Location

13537960-13668170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13668022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 3 (I3T)

Ref Sequence

ENSEMBL: ENSMUSP00000055969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023365] [ENSMUST00000035426] [ENSMUST00000058884] [ENSMUST00000069281] [ENSMUST00000127973] [ENSMUST00000229042] [ENSMUST00000231003]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023365

SMART Domains

Protein: ENSMUSP00000023365
Gene: ENSMUSG00000022684

Domain	Start	End	E-Value	Type
RING	34	73	2.71e-6	SMART
transmembrane domain	142	164	N/A	INTRINSIC
SAM	179	249	1.82e-6	SMART
transmembrane domain	361	380	N/A	INTRINSIC
transmembrane domain	407	429	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000035426

SMART Domains

Protein: ENSMUSP00000041742
Gene: ENSMUSG00000079737

Domain	Start	End	E-Value	Type
low complexity region	68	78	N/A	INTRINSIC
low complexity region	97	114	N/A	INTRINSIC
low complexity region	162	171	N/A	INTRINSIC
Pfam:Lge1	226	301	8e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058884
AA Change: I3T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: I3T

Domain	Start	End	E-Value	Type
Pfam:CAF1	3	383	2.7e-86	PFAM
Pfam:R3H	172	236	2.8e-13	PFAM
Pfam:RNA_bind	430	508	2.2e-37	PFAM
low complexity region	564	578	N/A	INTRINSIC
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000069281

SMART Domains

Protein: ENSMUSP00000063371
Gene: ENSMUSG00000022684

Domain	Start	End	E-Value	Type
RING	34	73	2.71e-6	SMART
low complexity region	86	97	N/A	INTRINSIC
PDB:1V85\|A	98	123	2e-8	PDB
Blast:SAM	98	124	2e-8	BLAST
transmembrane domain	236	255	N/A	INTRINSIC
transmembrane domain	282	304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127973

SMART Domains

Protein: ENSMUSP00000115585
Gene: ENSMUSG00000022684

Domain	Start	End	E-Value	Type
RING	34	73	2.71e-6	SMART
transmembrane domain	142	161	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132349

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225585

Predicted Effect

probably benign
Transcript: ENSMUST00000229042
AA Change: I3T

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229251

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229526

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231003
AA Change: I3T

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230905

Meta Mutation Damage Score

0.2600

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

94% (50/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	C	5: 8,726,873	L857P	probably damaging	Het
Adam12	T	C	7: 133,887,942	*582W	probably null	Het
Adra1d	A	G	2: 131,561,087	V361A	probably damaging	Het
Ank2	A	G	3: 126,944,049		probably benign	Het
Atxn10	T	A	15: 85,462,314	N424K	probably damaging	Het
C8b	A	G	4: 104,780,663	T111A	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdr2l	T	C	11: 115,393,570	V244A	possibly damaging	Het
Col11a2	A	G	17: 34,051,801	M468V	probably benign	Het
Col4a2	G	A	8: 11,445,984	R1535H	probably damaging	Het
Cryab	A	T	9: 50,753,451	S59C	probably damaging	Het
Cuzd1	G	A	7: 131,316,124	T249I	probably damaging	Het
Disp2	G	A	2: 118,786,911	V129M	probably benign	Het
Dlg2	G	T	7: 91,449,803	R31L	probably benign	Het
Dthd1	A	C	5: 62,839,387	L488F	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Fat2	T	G	11: 55,282,166	I2574L	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fryl	T	C	5: 73,073,904	D1610G	probably damaging	Het
Gm10330	T	A	12: 23,780,130	N17Y	probably damaging	Het
Gm4787	T	A	12: 81,377,465	R640*	probably null	Het
Gm8251	A	C	1: 44,057,979	C1320G	possibly damaging	Het
Hist1h2bl	A	T	13: 21,715,860	I95N	probably damaging	Het
Ift88	T	A	14: 57,438,242	S71T	probably benign	Het
Isoc2b	A	G	7: 4,849,358		probably benign	Het
Itgb2	G	T	10: 77,558,052	R442L	probably benign	Het
Lama5	A	T	2: 180,181,651	N2658K	possibly damaging	Het
Lemd3	A	T	10: 120,933,633	I598K	probably damaging	Het
Lrp2	A	T	2: 69,454,838	C3825*	probably null	Het
Mep1a	T	C	17: 43,477,146	D673G	probably damaging	Het
Met	A	G	6: 17,491,362	Y41C	probably damaging	Het
Mfn2	A	G	4: 147,894,578	V99A	probably damaging	Het
Mmadhc	A	G	2: 50,291,424	I78T	probably benign	Het
Mmp9	C	A	2: 164,950,992	P389T	possibly damaging	Het
Mvk	T	G	5: 114,452,438	S7A	probably damaging	Het
Nlrp1a	T	A	11: 71,124,251	T58S	probably benign	Het
Nlrp1c-ps	C	A	11: 71,258,013		noncoding transcript	Het
Nr1h3	A	G	2: 91,191,908	I125T	possibly damaging	Het
Olfr1089	A	T	2: 86,733,336	I92K	probably damaging	Het
Olfr443-ps1	C	T	6: 43,094,664		noncoding transcript	Het
Parp8	A	G	13: 116,862,204		probably null	Het
Parva	T	C	7: 112,544,268		probably null	Het
Pwp2	A	C	10: 78,175,544	I672M	possibly damaging	Het
Sfswap	C	T	5: 129,539,746	T418I	probably benign	Het
Slc6a3	A	G	13: 73,560,959	Y334C	probably damaging	Het
Slc7a13	C	A	4: 19,839,267	T290K	probably benign	Het
Spry2	A	G	14: 105,893,278	L158P	probably damaging	Het
Usp25	A	G	16: 77,050,454	E150G	probably damaging	Het
Zfp747	A	G	7: 127,374,597	F134L	possibly damaging	Het
Zp3r	A	G	1: 130,596,781	F175S	probably benign	Het
Zscan22	C	A	7: 12,906,508	N67K	probably benign	Het

Other mutations in Parn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Parn	APN	16	13667603	missense	probably benign
IGL02030:Parn	APN	16	13664650	splice site	probably null
IGL02179:Parn	APN	16	13667592	missense	probably benign	0.00
IGL02336:Parn	APN	16	13566703	missense	probably damaging	1.00
arlette	UTSW	16	13606171	missense	probably damaging	1.00
PIT4453001:Parn	UTSW	16	13607281	missense	probably benign	0.00
PIT4651001:Parn	UTSW	16	13631567	missense	probably benign	0.25
R0388:Parn	UTSW	16	13654476	missense	possibly damaging	0.72
R0485:Parn	UTSW	16	13654435	splice site	probably benign
R0625:Parn	UTSW	16	13640294	missense	probably benign	0.02
R1104:Parn	UTSW	16	13667585	missense	probably damaging	0.99
R1299:Parn	UTSW	16	13664729	missense	probably benign	0.10
R1356:Parn	UTSW	16	13650674	nonsense	probably null
R2067:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2111:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2397:Parn	UTSW	16	13566654	missense	probably benign
R4473:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4474:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4475:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4476:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4665:Parn	UTSW	16	13541103	missense	probably benign	0.19
R4795:Parn	UTSW	16	13606202	missense	probably benign	0.06
R5122:Parn	UTSW	16	13654447	critical splice donor site	probably null
R5226:Parn	UTSW	16	13625552	missense	probably benign
R5570:Parn	UTSW	16	13665930	missense	probably damaging	0.98
R5979:Parn	UTSW	16	13606171	missense	probably damaging	1.00
R6009:Parn	UTSW	16	13667564	missense	probably damaging	1.00
R6173:Parn	UTSW	16	13651811	missense	possibly damaging	0.82
R6493:Parn	UTSW	16	13656925	missense	probably damaging	1.00
R7055:Parn	UTSW	16	13626134	missense	possibly damaging	0.80
R7278:Parn	UTSW	16	13626063	splice site	probably null
R7391:Parn	UTSW	16	13668006	splice site	probably null
R7706:Parn	UTSW	16	13607253	missense	probably damaging	1.00
R8188:Parn	UTSW	16	13541156	missense	probably benign	0.01
R8317:Parn	UTSW	16	13541100	missense	probably damaging	0.96
R8326:Parn	UTSW	16	13665971	missense	probably benign	0.00
R8419:Parn	UTSW	16	13648474	missense	probably benign	0.11
R8433:Parn	UTSW	16	13667549	missense	probably damaging	1.00
R8475:Parn	UTSW	16	13607249	critical splice donor site	probably null
R8847:Parn	UTSW	16	13628406	nonsense	probably null
R8958:Parn	UTSW	16	13648458	missense	possibly damaging	0.64
R8988:Parn	UTSW	16	13648417	critical splice donor site	probably null
R9277:Parn	UTSW	16	13664655	critical splice donor site	probably null
R9476:Parn	UTSW	16	13541078	missense	probably benign	0.10
R9510:Parn	UTSW	16	13541078	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TTTGCAGAGCGACAAGTCC -3'
(R):5'- GAGACTTTGATAGCAATGCCCC -3'

Sequencing Primer
(F):5'- GAGCGACAAGTCCCACCAG -3'
(R):5'- TTTCTAGGCAGCCCGGAG -3'

Posted On

2016-08-04