Incidental Mutation 'R5355:Parn'
ID 424063
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Name poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms DAN, 1200003I18Rik
MMRRC Submission 042934-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R5355 (G1)
Quality Score 156
Status Validated
Chromosome 16
Chromosomal Location 13537960-13668170 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13668022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 3 (I3T)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023365] [ENSMUST00000035426] [ENSMUST00000058884] [ENSMUST00000069281] [ENSMUST00000127973] [ENSMUST00000229042] [ENSMUST00000231003]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023365
SMART Domains Protein: ENSMUSP00000023365
Gene: ENSMUSG00000022684

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
transmembrane domain 142 164 N/A INTRINSIC
SAM 179 249 1.82e-6 SMART
transmembrane domain 361 380 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035426
SMART Domains Protein: ENSMUSP00000041742
Gene: ENSMUSG00000079737

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 162 171 N/A INTRINSIC
Pfam:Lge1 226 301 8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000058884
AA Change: I3T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: I3T

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069281
SMART Domains Protein: ENSMUSP00000063371
Gene: ENSMUSG00000022684

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
low complexity region 86 97 N/A INTRINSIC
PDB:1V85|A 98 123 2e-8 PDB
Blast:SAM 98 124 2e-8 BLAST
transmembrane domain 236 255 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127973
SMART Domains Protein: ENSMUSP00000115585
Gene: ENSMUSG00000022684

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
transmembrane domain 142 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225585
Predicted Effect probably benign
Transcript: ENSMUST00000229042
AA Change: I3T

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229526
Predicted Effect possibly damaging
Transcript: ENSMUST00000231003
AA Change: I3T

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230905
Meta Mutation Damage Score 0.2600 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13667603 missense probably benign
IGL02030:Parn APN 16 13664650 splice site probably null
IGL02179:Parn APN 16 13667592 missense probably benign 0.00
IGL02336:Parn APN 16 13566703 missense probably damaging 1.00
arlette UTSW 16 13606171 missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13607281 missense probably benign 0.00
PIT4651001:Parn UTSW 16 13631567 missense probably benign 0.25
R0388:Parn UTSW 16 13654476 missense possibly damaging 0.72
R0485:Parn UTSW 16 13654435 splice site probably benign
R0625:Parn UTSW 16 13640294 missense probably benign 0.02
R1104:Parn UTSW 16 13667585 missense probably damaging 0.99
R1299:Parn UTSW 16 13664729 missense probably benign 0.10
R1356:Parn UTSW 16 13650674 nonsense probably null
R2067:Parn UTSW 16 13603069 missense probably damaging 1.00
R2111:Parn UTSW 16 13603069 missense probably damaging 1.00
R2397:Parn UTSW 16 13566654 missense probably benign
R4473:Parn UTSW 16 13664685 missense probably benign 0.00
R4474:Parn UTSW 16 13664685 missense probably benign 0.00
R4475:Parn UTSW 16 13664685 missense probably benign 0.00
R4476:Parn UTSW 16 13664685 missense probably benign 0.00
R4665:Parn UTSW 16 13541103 missense probably benign 0.19
R4795:Parn UTSW 16 13606202 missense probably benign 0.06
R5122:Parn UTSW 16 13654447 critical splice donor site probably null
R5226:Parn UTSW 16 13625552 missense probably benign
R5570:Parn UTSW 16 13665930 missense probably damaging 0.98
R5979:Parn UTSW 16 13606171 missense probably damaging 1.00
R6009:Parn UTSW 16 13667564 missense probably damaging 1.00
R6173:Parn UTSW 16 13651811 missense possibly damaging 0.82
R6493:Parn UTSW 16 13656925 missense probably damaging 1.00
R7055:Parn UTSW 16 13626134 missense possibly damaging 0.80
R7278:Parn UTSW 16 13626063 splice site probably null
R7391:Parn UTSW 16 13668006 splice site probably null
R7706:Parn UTSW 16 13607253 missense probably damaging 1.00
R8188:Parn UTSW 16 13541156 missense probably benign 0.01
R8317:Parn UTSW 16 13541100 missense probably damaging 0.96
R8326:Parn UTSW 16 13665971 missense probably benign 0.00
R8419:Parn UTSW 16 13648474 missense probably benign 0.11
R8433:Parn UTSW 16 13667549 missense probably damaging 1.00
R8475:Parn UTSW 16 13607249 critical splice donor site probably null
R8847:Parn UTSW 16 13628406 nonsense probably null
R8958:Parn UTSW 16 13648458 missense possibly damaging 0.64
R8988:Parn UTSW 16 13648417 critical splice donor site probably null
R9277:Parn UTSW 16 13664655 critical splice donor site probably null
R9476:Parn UTSW 16 13541078 missense probably benign 0.10
R9510:Parn UTSW 16 13541078 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTTGCAGAGCGACAAGTCC -3'
(R):5'- GAGACTTTGATAGCAATGCCCC -3'

Sequencing Primer
(F):5'- GAGCGACAAGTCCCACCAG -3'
(R):5'- TTTCTAGGCAGCCCGGAG -3'
Posted On 2016-08-04