Incidental Mutation 'R5355:Cdc45'
ID424064
Institutional Source Beutler Lab
Gene Symbol Cdc45
Ensembl Gene ENSMUSG00000000028
Gene Namecell division cycle 45
SynonymsCdc45l
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18780447-18811987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18795897 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 205 (R205H)
Ref Sequence ENSEMBL: ENSMUSP00000094753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000096990]
Predicted Effect probably damaging
Transcript: ENSMUST00000000028
AA Change: R251H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028
AA Change: R251H

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096990
AA Change: R205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028
AA Change: R205H

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Meta Mutation Damage Score 0.1932 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant embryos do not develop after implantation, resulting in embryonic lethality between E4.5-E5.5. Heterozygous animals appear normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Cdc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Cdc45 APN 16 18811561 missense probably damaging 1.00
IGL01677:Cdc45 APN 16 18787000 missense probably benign 0.02
IGL02079:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02080:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02105:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02106:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02237:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02238:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02239:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02371:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02441:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02442:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02465:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02466:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02468:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02469:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02470:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02471:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02472:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02473:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02489:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02490:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02491:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02492:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02511:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02558:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02559:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02560:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02561:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02562:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02566:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02567:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02576:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02583:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02589:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02626:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02627:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02628:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02629:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02687:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02688:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02689:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02720:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02724:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02731:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02738:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02991:Cdc45 UTSW 16 18798729 missense probably benign 0.06
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0458:Cdc45 UTSW 16 18781972 splice site probably benign
R1398:Cdc45 UTSW 16 18781971 splice site probably benign
R1413:Cdc45 UTSW 16 18808741 missense possibly damaging 0.63
R1792:Cdc45 UTSW 16 18807340 missense probably benign 0.01
R2919:Cdc45 UTSW 16 18808793 missense probably benign 0.00
R3956:Cdc45 UTSW 16 18805430 missense probably benign 0.00
R4079:Cdc45 UTSW 16 18811360 missense probably damaging 1.00
R4825:Cdc45 UTSW 16 18784863 missense probably damaging 0.98
R5028:Cdc45 UTSW 16 18795180 missense probably benign 0.43
R5214:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5215:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5309:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5311:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5312:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5352:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5353:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5354:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5356:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5424:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5426:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5655:Cdc45 UTSW 16 18807279 critical splice donor site probably null
R6174:Cdc45 UTSW 16 18794704 intron probably null
R6796:Cdc45 UTSW 16 18784857 missense probably damaging 1.00
R7910:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
R7991:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCATGACTCAGACATCGTC -3'
(R):5'- GTACCTAAAGATGGGGCATAGC -3'

Sequencing Primer
(F):5'- AGGACATGGGTGGTTCTATCAC -3'
(R):5'- ATAGCCTGGCCAGAGAGCAC -3'
Posted On2016-08-04