Mutagenetix > Incidental Mutations

Incidental Mutation 'R5355:Usp25'

424065

Institutional Source

Beutler Lab

Gene Symbol

Usp25

Ensembl Gene

ENSMUSG00000022867

Gene Name

ubiquitin specific peptidase 25

Synonyms

MMRRC Submission

042934-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77013706-77116780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77050454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 150 (E150G)

Ref Sequence

ENSEMBL: ENSMUSP00000023580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023580]

AlphaFold

P57080

PDB Structure

Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023580
AA Change: E150G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: E150G

Domain	Start	End	E-Value	Type
PDB:1VDL\|A	1	67	2e-35	PDB
Blast:UBA	17	56	9e-16	BLAST
UIM	97	116	5.27e-3	SMART
Pfam:UIM	124	140	6.7e-3	PFAM
Pfam:UCH	168	655	9.3e-55	PFAM
Pfam:UCH_1	169	632	3.1e-14	PFAM
coiled coil region	685	714	N/A	INTRINSIC

Meta Mutation Damage Score

0.5433

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

94% (50/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	C	5: 8,726,873	L857P	probably damaging	Het
Adam12	T	C	7: 133,887,942	*582W	probably null	Het
Adra1d	A	G	2: 131,561,087	V361A	probably damaging	Het
Ank2	A	G	3: 126,944,049		probably benign	Het
Atxn10	T	A	15: 85,462,314	N424K	probably damaging	Het
C8b	A	G	4: 104,780,663	T111A	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdr2l	T	C	11: 115,393,570	V244A	possibly damaging	Het
Col11a2	A	G	17: 34,051,801	M468V	probably benign	Het
Col4a2	G	A	8: 11,445,984	R1535H	probably damaging	Het
Cryab	A	T	9: 50,753,451	S59C	probably damaging	Het
Cuzd1	G	A	7: 131,316,124	T249I	probably damaging	Het
Disp2	G	A	2: 118,786,911	V129M	probably benign	Het
Dlg2	G	T	7: 91,449,803	R31L	probably benign	Het
Dthd1	A	C	5: 62,839,387	L488F	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Fat2	T	G	11: 55,282,166	I2574L	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fryl	T	C	5: 73,073,904	D1610G	probably damaging	Het
Gm10330	T	A	12: 23,780,130	N17Y	probably damaging	Het
Gm4787	T	A	12: 81,377,465	R640*	probably null	Het
Gm8251	A	C	1: 44,057,979	C1320G	possibly damaging	Het
Hist1h2bl	A	T	13: 21,715,860	I95N	probably damaging	Het
Ift88	T	A	14: 57,438,242	S71T	probably benign	Het
Isoc2b	A	G	7: 4,849,358		probably benign	Het
Itgb2	G	T	10: 77,558,052	R442L	probably benign	Het
Lama5	A	T	2: 180,181,651	N2658K	possibly damaging	Het
Lemd3	A	T	10: 120,933,633	I598K	probably damaging	Het
Lrp2	A	T	2: 69,454,838	C3825*	probably null	Het
Mep1a	T	C	17: 43,477,146	D673G	probably damaging	Het
Met	A	G	6: 17,491,362	Y41C	probably damaging	Het
Mfn2	A	G	4: 147,894,578	V99A	probably damaging	Het
Mmadhc	A	G	2: 50,291,424	I78T	probably benign	Het
Mmp9	C	A	2: 164,950,992	P389T	possibly damaging	Het
Mvk	T	G	5: 114,452,438	S7A	probably damaging	Het
Nlrp1a	T	A	11: 71,124,251	T58S	probably benign	Het
Nlrp1c-ps	C	A	11: 71,258,013		noncoding transcript	Het
Nr1h3	A	G	2: 91,191,908	I125T	possibly damaging	Het
Olfr1089	A	T	2: 86,733,336	I92K	probably damaging	Het
Olfr443-ps1	C	T	6: 43,094,664		noncoding transcript	Het
Parn	A	G	16: 13,668,022	I3T	possibly damaging	Het
Parp8	A	G	13: 116,862,204		probably null	Het
Parva	T	C	7: 112,544,268		probably null	Het
Pwp2	A	C	10: 78,175,544	I672M	possibly damaging	Het
Sfswap	C	T	5: 129,539,746	T418I	probably benign	Het
Slc6a3	A	G	13: 73,560,959	Y334C	probably damaging	Het
Slc7a13	C	A	4: 19,839,267	T290K	probably benign	Het
Spry2	A	G	14: 105,893,278	L158P	probably damaging	Het
Zfp747	A	G	7: 127,374,597	F134L	possibly damaging	Het
Zp3r	A	G	1: 130,596,781	F175S	probably benign	Het
Zscan22	C	A	7: 12,906,508	N67K	probably benign	Het

Other mutations in Usp25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Usp25	APN	16	77062405	missense	probably damaging	1.00
IGL01359:Usp25	APN	16	77059253	missense	probably damaging	1.00
IGL01380:Usp25	APN	16	77093678	missense	probably benign	0.06
IGL01614:Usp25	APN	16	77077117	missense	probably damaging	1.00
IGL02065:Usp25	APN	16	77083782	missense	probably benign	0.06
IGL02271:Usp25	APN	16	77115447	missense	probably damaging	1.00
IGL03184:Usp25	APN	16	77081653	missense	probably damaging	1.00
IGL03046:Usp25	UTSW	16	77074866	missense	probably damaging	1.00
R0433:Usp25	UTSW	16	77109217	missense	probably benign	0.02
R0741:Usp25	UTSW	16	77071708	missense	possibly damaging	0.80
R0944:Usp25	UTSW	16	77081447	splice site	probably benign
R1324:Usp25	UTSW	16	77080387	missense	probably damaging	0.98
R1341:Usp25	UTSW	16	77115443	missense	probably benign
R1373:Usp25	UTSW	16	77062385	splice site	probably benign
R1641:Usp25	UTSW	16	77071671	missense	possibly damaging	0.89
R1777:Usp25	UTSW	16	77081554	missense	probably damaging	1.00
R1813:Usp25	UTSW	16	77114950	missense	probably benign	0.00
R1960:Usp25	UTSW	16	77076371	missense	probably damaging	1.00
R2256:Usp25	UTSW	16	77113794	missense	probably benign
R2271:Usp25	UTSW	16	77076429	missense	probably damaging	0.97
R4404:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4408:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4502:Usp25	UTSW	16	77115396	missense	probably damaging	1.00
R4604:Usp25	UTSW	16	77115415	missense	probably damaging	1.00
R4612:Usp25	UTSW	16	77033945	missense	possibly damaging	0.92
R4744:Usp25	UTSW	16	77114989	missense	probably damaging	1.00
R4867:Usp25	UTSW	16	77050467	missense	probably damaging	1.00
R4932:Usp25	UTSW	16	77033982	critical splice donor site	probably null
R5087:Usp25	UTSW	16	77077119	missense	probably benign	0.00
R5165:Usp25	UTSW	16	77076405	missense	possibly damaging	0.85
R5184:Usp25	UTSW	16	77109227	missense	probably benign	0.00
R5307:Usp25	UTSW	16	77093706	missense	probably benign
R5331:Usp25	UTSW	16	77050558	missense	probably damaging	1.00
R5479:Usp25	UTSW	16	77107913	missense	possibly damaging	0.51
R5619:Usp25	UTSW	16	77033945	missense	probably benign	0.22
R5646:Usp25	UTSW	16	77050472	missense	probably benign	0.34
R5946:Usp25	UTSW	16	77115054	nonsense	probably null
R6013:Usp25	UTSW	16	77077021	missense	probably benign	0.00
R6418:Usp25	UTSW	16	77062442	missense	probably damaging	1.00
R6653:Usp25	UTSW	16	77059288	missense	probably benign	0.29
R6709:Usp25	UTSW	16	77083932	missense	probably benign
R6987:Usp25	UTSW	16	77077180	missense	probably damaging	1.00
R7418:Usp25	UTSW	16	77113842	nonsense	probably null
R7500:Usp25	UTSW	16	77077201	missense	probably damaging	1.00
R7886:Usp25	UTSW	16	77113771	missense	probably damaging	0.99
R7961:Usp25	UTSW	16	77059262	missense	probably damaging	1.00
R8005:Usp25	UTSW	16	77077068	missense	probably benign
R8046:Usp25	UTSW	16	77109175	missense	probably damaging	1.00
R8069:Usp25	UTSW	16	77069055	missense	possibly damaging	0.58
R8140:Usp25	UTSW	16	77071681	nonsense	probably null
R8167:Usp25	UTSW	16	77107931	missense	probably damaging	1.00
R8437:Usp25	UTSW	16	77033912	missense	probably damaging	1.00
R8704:Usp25	UTSW	16	77059290	missense	probably benign	0.00
R8903:Usp25	UTSW	16	77081533	missense	probably damaging	1.00
R9123:Usp25	UTSW	16	77115081	critical splice donor site	probably null
R9276:Usp25	UTSW	16	77113833	missense	probably benign	0.09
R9286:Usp25	UTSW	16	77107976	missense	probably damaging	1.00
R9368:Usp25	UTSW	16	77107955	missense	probably damaging	1.00
X0065:Usp25	UTSW	16	77081556	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77071791	missense	probably damaging	0.98
Z1176:Usp25	UTSW	16	77071792	missense	possibly damaging	0.93
Z1176:Usp25	UTSW	16	77081521	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77083913	missense	probably benign
Z1176:Usp25	UTSW	16	77113830	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACTGCCATGTTCTTAATCACG -3'
(R):5'- TGAAAACCCTGCCTGAGTTTC -3'

Sequencing Primer
(F):5'- CGTCCAACGGCTACTTGAG -3'
(R):5'- GAAAACCCTGCCTGAGTTTCTACTTG -3'

Posted On

2016-08-04