Incidental Mutation 'R5355:Fchsd1'
ID424068
Institutional Source Beutler Lab
Gene Symbol Fchsd1
Ensembl Gene ENSMUSG00000038524
Gene NameFCH and double SH3 domains 1
SynonymsA030002D08Rik
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37957431-37969774 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 37959873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043437] [ENSMUST00000043498] [ENSMUST00000070709] [ENSMUST00000091932] [ENSMUST00000163128] [ENSMUST00000163591] [ENSMUST00000168056] [ENSMUST00000169360] [ENSMUST00000169498] [ENSMUST00000176104] [ENSMUST00000176902] [ENSMUST00000177058]
Predicted Effect probably benign
Transcript: ENSMUST00000043437
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043498
SMART Domains Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 11 315 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070709
SMART Domains Protein: ENSMUSP00000070280
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091932
SMART Domains Protein: ENSMUSP00000089552
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 8.3e-23 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153945
Predicted Effect probably benign
Transcript: ENSMUST00000163128
SMART Domains Protein: ENSMUSP00000127234
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163591
SMART Domains Protein: ENSMUSP00000129299
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166727
Predicted Effect probably benign
Transcript: ENSMUST00000168056
SMART Domains Protein: ENSMUSP00000130051
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.9e-23 PFAM
low complexity region 104 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169360
SMART Domains Protein: ENSMUSP00000129880
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 4.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169498
SMART Domains Protein: ENSMUSP00000128949
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176104
SMART Domains Protein: ENSMUSP00000135556
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 60 3.3e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176902
SMART Domains Protein: ENSMUSP00000135176
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177058
SMART Domains Protein: ENSMUSP00000135615
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mfn2 A G 4: 147,894,578 V99A probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Fchsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Fchsd1 APN 18 37965893 intron probably benign
IGL01097:Fchsd1 APN 18 37967757 splice site probably null
IGL02069:Fchsd1 APN 18 37967614 nonsense probably null
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0755:Fchsd1 UTSW 18 37968750 splice site probably null
R1524:Fchsd1 UTSW 18 37965897 critical splice donor site probably null
R2041:Fchsd1 UTSW 18 37967676 critical splice acceptor site probably null
R3820:Fchsd1 UTSW 18 37969457 splice site probably benign
R3821:Fchsd1 UTSW 18 37969457 splice site probably benign
R4998:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5017:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5018:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5022:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5023:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5047:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5240:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5309:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5312:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5353:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5354:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5424:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5517:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5518:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5521:Fchsd1 UTSW 18 37966484 missense probably damaging 1.00
R5590:Fchsd1 UTSW 18 37961327 missense probably damaging 1.00
R5607:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5608:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5810:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5828:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5906:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5949:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5958:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5969:Fchsd1 UTSW 18 37959873 unclassified probably benign
R6245:Fchsd1 UTSW 18 37962775 missense probably damaging 1.00
R6322:Fchsd1 UTSW 18 37965700 missense probably benign 0.00
R6433:Fchsd1 UTSW 18 37964084 missense possibly damaging 0.91
R6439:Fchsd1 UTSW 18 37969434 missense probably damaging 0.97
R6460:Fchsd1 UTSW 18 37959844 splice site probably null
R6488:Fchsd1 UTSW 18 37967268 intron probably null
R6650:Fchsd1 UTSW 18 37966502 nonsense probably null
R7331:Fchsd1 UTSW 18 37968770 missense possibly damaging 0.95
R7715:Fchsd1 UTSW 18 37966642 intron probably null
R8140:Fchsd1 UTSW 18 37964342 missense probably damaging 1.00
X0024:Fchsd1 UTSW 18 37969391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGTCTTAGGAATATCCCTGAC -3'
(R):5'- CAATAGGCATTTTGAGGGGC -3'

Sequencing Primer
(F):5'- GTCTTAGGAATATCCCTGACAATTC -3'
(R):5'- TTTATAGCTTAGGCTGCTG -3'
Posted On2016-08-04