Incidental Mutation 'R5356:Txlna'
ID424091
Institutional Source Beutler Lab
Gene Symbol Txlna
Ensembl Gene ENSMUSG00000053841
Gene Nametaxilin alpha
Synonyms2600010N21Rik, Txln, IL14
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129626078-129641065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129630373 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 397 (F397S)
Ref Sequence ENSEMBL: ENSMUSP00000081285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046425] [ENSMUST00000084264] [ENSMUST00000132217] [ENSMUST00000133803] [ENSMUST00000154105]
Predicted Effect probably damaging
Transcript: ENSMUST00000046425
AA Change: F397S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042153
Gene: ENSMUSG00000053841
AA Change: F397S

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 169 478 9.1e-120 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084264
AA Change: F397S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081285
Gene: ENSMUSG00000053841
AA Change: F397S

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 166 478 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132217
SMART Domains Protein: ENSMUSP00000118301
Gene: ENSMUSG00000053841

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 166 248 3.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133803
SMART Domains Protein: ENSMUSP00000117368
Gene: ENSMUSG00000053841

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 166 296 2.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142577
Predicted Effect probably benign
Transcript: ENSMUST00000154105
SMART Domains Protein: ENSMUSP00000122382
Gene: ENSMUSG00000053841

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 166 254 2.7e-28 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Txlna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Txlna APN 4 129634365 unclassified probably benign
IGL01472:Txlna APN 4 129632115 missense probably damaging 0.99
IGL02169:Txlna APN 4 129629613 missense probably damaging 0.99
IGL02801:Txlna APN 4 129640408 missense probably damaging 1.00
R0010:Txlna UTSW 4 129629086 missense probably benign 0.30
R0010:Txlna UTSW 4 129629086 missense probably benign 0.30
R0552:Txlna UTSW 4 129629191 missense probably benign 0.31
R1961:Txlna UTSW 4 129640262 missense probably benign
R2215:Txlna UTSW 4 129639318 missense possibly damaging 0.89
R2279:Txlna UTSW 4 129632142 missense probably damaging 1.00
R6354:Txlna UTSW 4 129634412 missense probably damaging 1.00
R7208:Txlna UTSW 4 129631278 critical splice donor site probably null
R7343:Txlna UTSW 4 129632160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAACTGTCCCCTCTGG -3'
(R):5'- GTCTTCCCAAGGCTGACTTTG -3'

Sequencing Primer
(F):5'- GGAGCTATGGCCCCTTCTAAC -3'
(R):5'- CCAAGGCTGACTTTGCAGGATTG -3'
Posted On2016-08-04