Incidental Mutation 'R5356:Muc3a'
ID 424097
Institutional Source Beutler Lab
Gene Symbol Muc3a
Ensembl Gene ENSMUSG00000094840
Gene Name mucin 3A, cell surface associated
Synonyms A630081J09Rik
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5356 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 137208813-137212389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137210564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 151 (I151V)
Ref Sequence ENSEMBL: ENSMUSP00000136061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179412]
AlphaFold Q3U5A2
Predicted Effect probably benign
Transcript: ENSMUST00000179412
AA Change: I151V

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136061
Gene: ENSMUSG00000094840
AA Change: I151V

DomainStartEndE-ValueType
Blast:EGF_like 54 95 1e-22 BLAST
transmembrane domain 103 125 N/A INTRINSIC
low complexity region 198 218 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000196391
AA Change: I149V
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mucin genes encode epithelial glycoproteins, some of which are secreted and some membrane bound. Each of the genes contains at least one large domain of tandemly repeated sequence that encodes the peptide sequence rich in serine and/or threonine residues, which carries most of the O-linked glycosylation (Gendler and Spicer, 1995 [PubMed 7778880]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Muc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1500:Muc3a UTSW 5 137210501 splice site probably benign
R1536:Muc3a UTSW 5 137210081 missense unknown
R5076:Muc3a UTSW 5 137210540 missense probably damaging 0.99
R6134:Muc3a UTSW 5 137210122 missense probably damaging 0.99
R6491:Muc3a UTSW 5 137212128 missense probably benign 0.00
R7524:Muc3a UTSW 5 137210563 missense probably benign 0.08
R8181:Muc3a UTSW 5 137210078 missense unknown
R9125:Muc3a UTSW 5 137210753 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTGGGAATCTCCACTC -3'
(R):5'- TTCCACAGACACGTACTGGG -3'

Sequencing Primer
(F):5'- TCTGGGAATCTCCACTCCTGGG -3'
(R):5'- AGGCCCACGCTGTGAGTTG -3'
Posted On 2016-08-04