Incidental Mutation 'R5356:Ret'
ID 424099
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
MMRRC Submission 042935-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R5356 (G1)
Quality Score 135
Status Not validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118174079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 6 (S6P)
Ref Sequence ENSEMBL: ENSMUSP00000086169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
Predicted Effect possibly damaging
Transcript: ENSMUST00000032201
AA Change: S6P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: S6P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088790
AA Change: S6P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: S6P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,119,405 (GRCm39) T162I probably damaging Het
Adam22 C A 5: 8,140,182 (GRCm39) G202W probably damaging Het
Amn1 T C 6: 149,068,392 (GRCm39) I205M possibly damaging Het
Ankrd50 A C 3: 38,510,334 (GRCm39) S678A probably damaging Het
Atg13 G A 2: 91,522,811 (GRCm39) R78* probably null Het
Bmper T G 9: 23,285,157 (GRCm39) F235L probably benign Het
Btn2a2 C T 13: 23,667,045 (GRCm39) V187I probably benign Het
Cabs1 G A 5: 88,127,492 (GRCm39) V48I probably benign Het
Cacnb3 A G 15: 98,539,498 (GRCm39) I212V probably damaging Het
Cdc45 C T 16: 18,614,647 (GRCm39) R205H probably damaging Het
Cep162 T C 9: 87,088,948 (GRCm39) E978G probably damaging Het
Cmya5 A T 13: 93,199,993 (GRCm39) L3445Q probably damaging Het
Cntrl T A 2: 35,038,911 (GRCm39) L1067* probably null Het
Cyp20a1 G A 1: 60,418,546 (GRCm39) V329I probably benign Het
Cyp2d11 A T 15: 82,274,712 (GRCm39) N288K probably benign Het
D430041D05Rik T G 2: 104,085,754 (GRCm39) T932P probably damaging Het
Dlk1 T A 12: 109,421,447 (GRCm39) C54S probably damaging Het
Dusp29 G A 14: 21,727,091 (GRCm39) R186W probably benign Het
Entpd6 T A 2: 150,612,303 (GRCm39) F416L probably damaging Het
Evx1 A G 6: 52,293,602 (GRCm39) T257A probably benign Het
Fpr-rs3 A T 17: 20,844,596 (GRCm39) S182T probably damaging Het
Glra3 A T 8: 56,393,936 (GRCm39) I16F probably benign Het
Gm11437 C A 11: 84,043,513 (GRCm39) L259F possibly damaging Het
Gorasp1 A T 9: 119,757,024 (GRCm39) L386Q probably damaging Het
Gpsm1 T C 2: 26,230,574 (GRCm39) V508A possibly damaging Het
Gstm1 T A 3: 107,920,052 (GRCm39) I180F probably benign Het
Hc T C 2: 34,885,007 (GRCm39) D1400G probably benign Het
Lrp2 A G 2: 69,295,052 (GRCm39) V3422A possibly damaging Het
Map3k4 A G 17: 12,466,195 (GRCm39) V1128A possibly damaging Het
Mboat2 G C 12: 25,007,572 (GRCm39) V363L probably benign Het
Mgat3 A G 15: 80,095,811 (GRCm39) I213V possibly damaging Het
Mgat3 A G 15: 80,096,655 (GRCm39) N494S probably damaging Het
Mtf2 A T 5: 108,254,476 (GRCm39) T426S possibly damaging Het
Muc3a T C 5: 137,245,021 (GRCm39) I151V probably benign Het
Myh6 T C 14: 55,191,219 (GRCm39) E874G probably damaging Het
Myo15a G A 11: 60,389,192 (GRCm39) G2030R probably damaging Het
Ncdn T C 4: 126,641,021 (GRCm39) Y493C probably damaging Het
Ncoa6 A G 2: 155,263,112 (GRCm39) F441L probably damaging Het
Ndc80 A T 17: 71,828,103 (GRCm39) S75T possibly damaging Het
Nf1 T C 11: 79,364,282 (GRCm39) F1571L possibly damaging Het
Nherf2 A G 17: 24,860,945 (GRCm39) V88A probably damaging Het
Nme8 A G 13: 19,836,469 (GRCm39) F236L probably damaging Het
Nsmce4a C A 7: 130,138,778 (GRCm39) V289L probably damaging Het
Ntrk2 A T 13: 59,208,056 (GRCm39) D634V probably damaging Het
Pcsk6 G C 7: 65,620,340 (GRCm39) E479Q probably damaging Het
Pkd1 A G 17: 24,812,551 (GRCm39) Q3828R probably damaging Het
Ptov1 T A 7: 44,514,089 (GRCm39) T295S probably damaging Het
Ptprf A G 4: 118,083,535 (GRCm39) M824T probably benign Het
Rbm6 T A 9: 107,729,865 (GRCm39) H129L probably damaging Het
Rbm8a2 A G 1: 175,806,255 (GRCm39) I74T possibly damaging Het
Rspo3 A T 10: 29,376,064 (GRCm39) C70* probably null Het
Sike1 C A 3: 102,909,106 (GRCm39) A202D possibly damaging Het
Slco4c1 G T 1: 96,759,835 (GRCm39) P499H probably damaging Het
Smg1 A G 7: 117,794,356 (GRCm39) probably benign Het
Tmem135 A G 7: 88,954,723 (GRCm39) V98A probably benign Het
Tor4a T A 2: 25,085,918 (GRCm39) probably null Het
Txlna A G 4: 129,524,166 (GRCm39) F397S probably damaging Het
Tyk2 A G 9: 21,027,040 (GRCm39) I581T probably benign Het
Unc13a C T 8: 72,115,158 (GRCm39) D164N probably benign Het
Vwa3b T C 1: 37,153,664 (GRCm39) I502T probably damaging Het
Xrcc6 A G 15: 81,913,419 (GRCm39) T6A probably benign Het
Zfp524 T C 7: 5,021,432 (GRCm39) V320A probably benign Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118,141,702 (GRCm39) missense probably benign 0.04
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R0555:Ret UTSW 6 118,155,571 (GRCm39) missense probably damaging 0.96
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6412:Ret UTSW 6 118,161,245 (GRCm39) missense probably benign 0.00
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R6884:Ret UTSW 6 118,132,362 (GRCm39) missense probably damaging 1.00
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9051:Ret UTSW 6 118,142,888 (GRCm39) nonsense probably null
R9323:Ret UTSW 6 118,158,975 (GRCm39) missense probably benign 0.00
R9661:Ret UTSW 6 118,150,437 (GRCm39) missense probably benign
R9674:Ret UTSW 6 118,130,830 (GRCm39) missense probably damaging 1.00
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGCTTGGGATGTTCAGCTGC -3'
(R):5'- AGGTCTCTCATCAGTACCGCAAC -3'

Sequencing Primer
(F):5'- TCGCAACTCGCACGGAC -3'
(R):5'- GAGCCGTGCAAGCAACAGC -3'
Posted On 2016-08-04