Incidental Mutation 'R0488:Samd4b'
ID42410
Institutional Source Beutler Lab
Gene Symbol Samd4b
Ensembl Gene ENSMUSG00000109336
Gene Namesterile alpha motif domain containing 4B
Synonyms
MMRRC Submission 038687-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R0488 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28399522-28598144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28414237 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 101 (Y101C)
Ref Sequence ENSEMBL: ENSMUSP00000147037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000207766] [ENSMUST00000208199]
Predicted Effect probably damaging
Transcript: ENSMUST00000040531
AA Change: Y101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336
AA Change: Y101C

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207766
AA Change: Y101C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208199
AA Change: Y101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208676
Meta Mutation Damage Score 0.7459 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T G 11: 46,138,930 L734R probably damaging Het
Adgrf1 T C 17: 43,310,411 I513T probably damaging Het
Adgrl2 A G 3: 148,846,905 V654A probably damaging Het
Agl A T 3: 116,754,962 Y1249* probably null Het
Ankar T A 1: 72,658,732 Q996H probably damaging Het
Aqp12 T C 1: 93,008,656 Y235H probably damaging Het
Arsb T C 13: 93,940,505 V460A probably benign Het
Baiap3 A G 17: 25,248,470 probably null Het
Cd44 T C 2: 102,834,219 probably benign Het
Clec4b1 T A 6: 123,071,482 I192N probably damaging Het
Cps1 A C 1: 67,148,808 probably benign Het
Dab2 T C 15: 6,424,654 L215S probably damaging Het
E2f4 G A 8: 105,298,539 V84I probably damaging Het
Edem2 T C 2: 155,716,123 T197A probably damaging Het
Eno2 T A 6: 124,763,874 M121L probably benign Het
Ephb1 A G 9: 101,964,008 V757A probably damaging Het
Etv5 T A 16: 22,412,945 I106F probably damaging Het
Foxj3 T A 4: 119,619,990 Y298* probably null Het
Gm12185 A G 11: 48,907,839 L609S probably damaging Het
Gm5884 T C 6: 128,646,068 noncoding transcript Het
Havcr1 A G 11: 46,752,571 Y106C probably damaging Het
Jmjd1c A G 10: 67,240,727 N2110S probably damaging Het
Kif2b T C 11: 91,576,972 K162E probably benign Het
Micu2 T C 14: 57,932,242 Y217C probably benign Het
Mink1 G T 11: 70,597,204 G32C probably damaging Het
Mnat1 T A 12: 73,170,639 N96K probably damaging Het
Mpp2 G T 11: 102,061,601 R349S possibly damaging Het
Mrpl13 T A 15: 55,539,148 I59F probably benign Het
Mybl2 T C 2: 163,072,614 probably benign Het
Otogl T C 10: 107,803,605 E1382G probably benign Het
Pclo A G 5: 14,669,299 E1150G unknown Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pla2g4a G A 1: 149,871,445 T322M probably damaging Het
Pramef6 A T 4: 143,895,403 Y461N probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptprg A T 14: 12,220,653 D455V probably damaging Het
Ptprt T C 2: 161,553,825 T1162A probably damaging Het
Rad51ap1 T C 6: 126,934,760 N55D possibly damaging Het
Rc3h2 T C 2: 37,389,588 E543G probably damaging Het
Rimklb G A 6: 122,460,975 T103I probably benign Het
Rsg1 A G 4: 141,214,401 D14G probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tubgcp5 T A 7: 55,829,338 S979T probably damaging Het
Vmn2r93 G A 17: 18,326,049 E728K probably damaging Het
Wdr17 T C 8: 54,693,052 probably benign Het
Wdr90 T C 17: 25,848,617 Y1457C probably damaging Het
Wsb1 T C 11: 79,244,500 D225G probably damaging Het
Xirp2 T C 2: 67,514,821 S2469P possibly damaging Het
Zeb1 T A 18: 5,772,455 C915S probably damaging Het
Znfx1 C A 2: 167,042,563 R923L possibly damaging Het
Other mutations in Samd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Samd4b APN 7 28401877 missense probably damaging 1.00
IGL00979:Samd4b APN 7 28414213 missense probably damaging 1.00
IGL01336:Samd4b APN 7 28413963 missense probably benign 0.00
IGL01432:Samd4b APN 7 28414066 missense possibly damaging 0.60
IGL01895:Samd4b APN 7 28401909 critical splice acceptor site probably null
IGL02827:Samd4b APN 7 28414121 missense probably damaging 1.00
IGL03077:Samd4b APN 7 28406443 missense probably damaging 0.99
IGL03055:Samd4b UTSW 7 28405546 missense possibly damaging 0.89
R0367:Samd4b UTSW 7 28423448 missense probably damaging 1.00
R0390:Samd4b UTSW 7 28403977 missense probably benign 0.13
R0440:Samd4b UTSW 7 28408160 missense probably benign 0.45
R0798:Samd4b UTSW 7 28401623 splice site probably benign
R1233:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1234:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1481:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1643:Samd4b UTSW 7 28423616 missense probably damaging 1.00
R1675:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1768:Samd4b UTSW 7 28413892 missense probably benign 0.36
R1801:Samd4b UTSW 7 28407331 splice site probably null
R2831:Samd4b UTSW 7 28403913 missense probably damaging 0.99
R4505:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4507:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4731:Samd4b UTSW 7 28406663 missense probably benign 0.00
R5811:Samd4b UTSW 7 28408020 missense probably damaging 1.00
R6063:Samd4b UTSW 7 28423631 start codon destroyed possibly damaging 0.71
R6114:Samd4b UTSW 7 28522792 unclassified probably null
R6356:Samd4b UTSW 7 28401593 missense probably damaging 1.00
R6467:Samd4b UTSW 7 28401860 missense probably damaging 1.00
R7055:Samd4b UTSW 7 28404033 missense probably benign 0.01
R7191:Samd4b UTSW 7 28414261 missense probably benign 0.18
R7371:Samd4b UTSW 7 28423501 missense probably benign 0.33
R7445:Samd4b UTSW 7 28406456 missense probably benign 0.00
R7543:Samd4b UTSW 7 28414286 missense probably benign 0.02
R7663:Samd4b UTSW 7 28423500 nonsense probably null
R7746:Samd4b UTSW 7 28403903 missense probably damaging 1.00
R8235:Samd4b UTSW 7 28406606 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCATCTGAGCCCTGGCGTGAATG -3'
(R):5'- ACTTCCACATGACTGCCTGGACTG -3'

Sequencing Primer
(F):5'- CCTGGCGTGAATGGTAGGAG -3'
(R):5'- acgcctttaatcccagcac -3'
Posted On2013-05-23