Incidental Mutation 'R0488:Tubgcp5'
ID42411
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Nametubulin, gamma complex associated protein 5
SynonymsB130010C12Rik, GCP5
MMRRC Submission 038687-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0488 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55794154-55831677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55829338 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 979 (S979T)
Ref Sequence ENSEMBL: ENSMUSP00000032627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206133] [ENSMUST00000206191]
Predicted Effect probably damaging
Transcript: ENSMUST00000032627
AA Change: S979T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: S979T

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205311
Predicted Effect probably benign
Transcript: ENSMUST00000205796
AA Change: S916T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect unknown
Transcript: ENSMUST00000206133
AA Change: I43N
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206789
Meta Mutation Damage Score 0.3302 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T G 11: 46,138,930 L734R probably damaging Het
Adgrf1 T C 17: 43,310,411 I513T probably damaging Het
Adgrl2 A G 3: 148,846,905 V654A probably damaging Het
Agl A T 3: 116,754,962 Y1249* probably null Het
Ankar T A 1: 72,658,732 Q996H probably damaging Het
Aqp12 T C 1: 93,008,656 Y235H probably damaging Het
Arsb T C 13: 93,940,505 V460A probably benign Het
Baiap3 A G 17: 25,248,470 probably null Het
Cd44 T C 2: 102,834,219 probably benign Het
Clec4b1 T A 6: 123,071,482 I192N probably damaging Het
Cps1 A C 1: 67,148,808 probably benign Het
Dab2 T C 15: 6,424,654 L215S probably damaging Het
E2f4 G A 8: 105,298,539 V84I probably damaging Het
Edem2 T C 2: 155,716,123 T197A probably damaging Het
Eno2 T A 6: 124,763,874 M121L probably benign Het
Ephb1 A G 9: 101,964,008 V757A probably damaging Het
Etv5 T A 16: 22,412,945 I106F probably damaging Het
Foxj3 T A 4: 119,619,990 Y298* probably null Het
Gm12185 A G 11: 48,907,839 L609S probably damaging Het
Gm5884 T C 6: 128,646,068 noncoding transcript Het
Havcr1 A G 11: 46,752,571 Y106C probably damaging Het
Jmjd1c A G 10: 67,240,727 N2110S probably damaging Het
Kif2b T C 11: 91,576,972 K162E probably benign Het
Micu2 T C 14: 57,932,242 Y217C probably benign Het
Mink1 G T 11: 70,597,204 G32C probably damaging Het
Mnat1 T A 12: 73,170,639 N96K probably damaging Het
Mpp2 G T 11: 102,061,601 R349S possibly damaging Het
Mrpl13 T A 15: 55,539,148 I59F probably benign Het
Mybl2 T C 2: 163,072,614 probably benign Het
Otogl T C 10: 107,803,605 E1382G probably benign Het
Pclo A G 5: 14,669,299 E1150G unknown Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pla2g4a G A 1: 149,871,445 T322M probably damaging Het
Pramef6 A T 4: 143,895,403 Y461N probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptprg A T 14: 12,220,653 D455V probably damaging Het
Ptprt T C 2: 161,553,825 T1162A probably damaging Het
Rad51ap1 T C 6: 126,934,760 N55D possibly damaging Het
Rc3h2 T C 2: 37,389,588 E543G probably damaging Het
Rimklb G A 6: 122,460,975 T103I probably benign Het
Rsg1 A G 4: 141,214,401 D14G probably benign Het
Samd4b T C 7: 28,414,237 Y101C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Vmn2r93 G A 17: 18,326,049 E728K probably damaging Het
Wdr17 T C 8: 54,693,052 probably benign Het
Wdr90 T C 17: 25,848,617 Y1457C probably damaging Het
Wsb1 T C 11: 79,244,500 D225G probably damaging Het
Xirp2 T C 2: 67,514,821 S2469P possibly damaging Het
Zeb1 T A 18: 5,772,455 C915S probably damaging Het
Znfx1 C A 2: 167,042,563 R923L possibly damaging Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55806595 missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55808529 missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55796031 splice site probably benign
IGL01597:Tubgcp5 APN 7 55806832 splice site probably benign
IGL01688:Tubgcp5 APN 7 55815018 missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55799473 missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55806088 missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55818757 missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55806607 nonsense probably null
IGL03105:Tubgcp5 APN 7 55825581 missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55808529 missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55814978 missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55800684 missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55823567 missense probably benign
R0853:Tubgcp5 UTSW 7 55814851 splice site probably benign
R0885:Tubgcp5 UTSW 7 55806055 nonsense probably null
R1483:Tubgcp5 UTSW 7 55825707 critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55808537 missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55815020 missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55799511 missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55830881 missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55830866 missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55794185 unclassified probably benign
R4948:Tubgcp5 UTSW 7 55806123 missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55808637 missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55823685 missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55814962 missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55823609 missense probably benign
R6141:Tubgcp5 UTSW 7 55806778 missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55795923 missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55817392 nonsense probably null
R6563:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55823583 missense probably benign
R6596:Tubgcp5 UTSW 7 55806634 missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55794229 missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55805366 missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55829407 missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55800695 nonsense probably null
R7213:Tubgcp5 UTSW 7 55806112 missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55823567 missense probably benign
R7600:Tubgcp5 UTSW 7 55808513 missense probably benign
R7813:Tubgcp5 UTSW 7 55800696 missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55816562 missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55794248 missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
Z1088:Tubgcp5 UTSW 7 55815101 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTACTTGGGAGCCTAAGCACAT -3'
(R):5'- GTGAGAGATCAACTCTCCAAGCTGC -3'

Sequencing Primer
(F):5'- CAGTTCTAGCCAATATGAGACTCTG -3'
(R):5'- GCTGCTACATCTCAGCTTTAGAAATC -3'
Posted On2013-05-23