Incidental Mutation 'R5356:Ntrk2'
ID424121
Institutional Source Beutler Lab
Gene Symbol Ntrk2
Ensembl Gene ENSMUSG00000055254
Gene Nameneurotrophic tyrosine kinase, receptor, type 2
SynonymsC030027L06Rik, Tkrb, trkB
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location58806569-59133970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59060242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 634 (D634V)
Ref Sequence ENSEMBL: ENSMUSP00000153553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000225488]
Predicted Effect probably damaging
Transcript: ENSMUST00000079828
AA Change: D634V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: D634V

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.2e-8 PFAM
transmembrane domain 431 453 N/A INTRINSIC
TyrKc 537 806 2.48e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225244
Predicted Effect probably damaging
Transcript: ENSMUST00000225488
AA Change: D634V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nme8 A G 13: 19,652,299 F236L probably damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Ntrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Ntrk2 APN 13 58846851 missense probably damaging 1.00
IGL02331:Ntrk2 APN 13 58846856 critical splice donor site probably null
IGL02465:Ntrk2 APN 13 59060380 missense probably damaging 1.00
PIT4366001:Ntrk2 UTSW 13 59060335 missense probably damaging 1.00
R0102:Ntrk2 UTSW 13 58808793 missense probably benign 0.00
R0547:Ntrk2 UTSW 13 58874370 missense probably damaging 0.99
R0615:Ntrk2 UTSW 13 59128186 nonsense probably null
R0620:Ntrk2 UTSW 13 58846821 missense probably benign
R1770:Ntrk2 UTSW 13 58861318 missense possibly damaging 0.67
R2063:Ntrk2 UTSW 13 58859297 missense probably damaging 1.00
R2089:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2178:Ntrk2 UTSW 13 58808802 missense probably benign 0.06
R2275:Ntrk2 UTSW 13 58861351 missense probably damaging 1.00
R2370:Ntrk2 UTSW 13 59054434 missense probably benign 0.28
R2413:Ntrk2 UTSW 13 58874412 missense possibly damaging 0.56
R2520:Ntrk2 UTSW 13 59054276 intron probably null
R2926:Ntrk2 UTSW 13 59060284 missense probably damaging 1.00
R4163:Ntrk2 UTSW 13 58860240 missense probably damaging 1.00
R4320:Ntrk2 UTSW 13 58860146 missense possibly damaging 0.48
R4348:Ntrk2 UTSW 13 58878259 missense probably damaging 1.00
R4440:Ntrk2 UTSW 13 59060312 missense probably damaging 1.00
R4534:Ntrk2 UTSW 13 59126529 missense probably damaging 1.00
R4695:Ntrk2 UTSW 13 59126493 missense probably damaging 0.99
R5471:Ntrk2 UTSW 13 58871760 missense probably benign 0.01
R5750:Ntrk2 UTSW 13 58808922 missense probably benign 0.02
R5916:Ntrk2 UTSW 13 58808729 start codon destroyed probably null 0.98
R5972:Ntrk2 UTSW 13 58837819 missense probably damaging 1.00
R6015:Ntrk2 UTSW 13 59060395 missense probably damaging 1.00
R6298:Ntrk2 UTSW 13 58871756 nonsense probably null
R6419:Ntrk2 UTSW 13 58861299 nonsense probably null
R6488:Ntrk2 UTSW 13 58861356 missense possibly damaging 0.93
R6611:Ntrk2 UTSW 13 59054414 missense probably damaging 1.00
R6827:Ntrk2 UTSW 13 59126568 missense probably damaging 1.00
R6911:Ntrk2 UTSW 13 58859215 missense probably damaging 1.00
R7387:Ntrk2 UTSW 13 58985979 missense probably damaging 1.00
R7445:Ntrk2 UTSW 13 58846762 missense probably benign 0.03
R7561:Ntrk2 UTSW 13 58861388 missense probably benign 0.31
R8031:Ntrk2 UTSW 13 58874379 missense probably benign
R8044:Ntrk2 UTSW 13 59126499 missense probably damaging 1.00
Z1176:Ntrk2 UTSW 13 58874333 missense probably benign
Z1177:Ntrk2 UTSW 13 58859273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTCGGTAGAAATGAGGC -3'
(R):5'- GTACACATCTCGGGACATCC -3'

Sequencing Primer
(F):5'- CTCGGTAGAAATGAGGCCGCTAG -3'
(R):5'- GGACATCCCAAAGTCCCCAATTTTC -3'
Posted On2016-08-04