Mutagenetix > Incidental Mutation

Incidental Mutation 'R0488:E2f4'

42413

Institutional Source

Beutler Lab

Gene Symbol

E2f4

Ensembl Gene

ENSMUSG00000014859

Gene Name

E2F transcription factor 4

Synonyms

2010111M04Rik

MMRRC Submission

038687-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0488 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106024295-106032002 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 106025171 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 84 (V84I)

Ref Sequence

ENSEMBL: ENSMUSP00000015003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000212777]

AlphaFold

Q8R0K9

Predicted Effect

probably damaging
Transcript: ENSMUST00000015003
AA Change: V84I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859
AA Change: V84I

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
E2F_TDP	17	83	3.56e-31	SMART
Pfam:E2F_CC-MB	100	196	2.8e-36	PFAM
low complexity region	201	252	N/A	INTRINSIC
low complexity region	360	372	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000057855

SMART Domains

Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251

Domain	Start	End	E-Value	Type
Pfam:Sec6	189	722	5.4e-116	PFAM
low complexity region	723	739	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212261

Predicted Effect

probably benign
Transcript: ENSMUST00000212777

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212974

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.7%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die postnatally of an increased susceptibility to bacterial infection and exhibit craniofacial defects, erythroid abnormalities, and growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	T	G	11: 46,029,757 (GRCm39)	L734R	probably damaging	Het
Adgrf1	T	C	17: 43,621,302 (GRCm39)	I513T	probably damaging	Het
Adgrl2	A	G	3: 148,552,541 (GRCm39)	V654A	probably damaging	Het
Agl	A	T	3: 116,548,611 (GRCm39)	Y1249*	probably null	Het
Ankar	T	A	1: 72,697,891 (GRCm39)	Q996H	probably damaging	Het
Aqp12	T	C	1: 92,936,378 (GRCm39)	Y235H	probably damaging	Het
Arsb	T	C	13: 94,077,013 (GRCm39)	V460A	probably benign	Het
Baiap3	A	G	17: 25,467,444 (GRCm39)		probably null	Het
Cd44	T	C	2: 102,664,564 (GRCm39)		probably benign	Het
Clec4b1	T	A	6: 123,048,441 (GRCm39)	I192N	probably damaging	Het
Cplane2	A	G	4: 140,941,712 (GRCm39)	D14G	probably benign	Het
Cps1	A	C	1: 67,187,967 (GRCm39)		probably benign	Het
Dab2	T	C	15: 6,454,135 (GRCm39)	L215S	probably damaging	Het
Edem2	T	C	2: 155,558,043 (GRCm39)	T197A	probably damaging	Het
Eno2	T	A	6: 124,740,837 (GRCm39)	M121L	probably benign	Het
Ephb1	A	G	9: 101,841,207 (GRCm39)	V757A	probably damaging	Het
Etv5	T	A	16: 22,231,695 (GRCm39)	I106F	probably damaging	Het
Foxj3	T	A	4: 119,477,187 (GRCm39)	Y298*	probably null	Het
Gm12185	A	G	11: 48,798,666 (GRCm39)	L609S	probably damaging	Het
Gm5884	T	C	6: 128,623,031 (GRCm39)		noncoding transcript	Het
Havcr1	A	G	11: 46,643,398 (GRCm39)	Y106C	probably damaging	Het
Jmjd1c	A	G	10: 67,076,506 (GRCm39)	N2110S	probably damaging	Het
Kif2b	T	C	11: 91,467,798 (GRCm39)	K162E	probably benign	Het
Micu2	T	C	14: 58,169,699 (GRCm39)	Y217C	probably benign	Het
Mink1	G	T	11: 70,488,030 (GRCm39)	G32C	probably damaging	Het
Mnat1	T	A	12: 73,217,413 (GRCm39)	N96K	probably damaging	Het
Mpp2	G	T	11: 101,952,427 (GRCm39)	R349S	possibly damaging	Het
Mrpl13	T	A	15: 55,402,544 (GRCm39)	I59F	probably benign	Het
Mybl2	T	C	2: 162,914,534 (GRCm39)		probably benign	Het
Otogl	T	C	10: 107,639,466 (GRCm39)	E1382G	probably benign	Het
Pclo	A	G	5: 14,719,313 (GRCm39)	E1150G	unknown	Het
Pkd1l3	C	G	8: 110,350,281 (GRCm39)	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 110,350,295 (GRCm39)	S380N	probably benign	Het
Pla2g4a	G	A	1: 149,747,196 (GRCm39)	T322M	probably damaging	Het
Pramel11	A	T	4: 143,621,973 (GRCm39)	Y461N	probably benign	Het
Prpsap2	A	G	11: 61,631,826 (GRCm39)	I177T	possibly damaging	Het
Ptprg	A	T	14: 12,220,653 (GRCm38)	D455V	probably damaging	Het
Ptprt	T	C	2: 161,395,745 (GRCm39)	T1162A	probably damaging	Het
Rad51ap1	T	C	6: 126,911,723 (GRCm39)	N55D	possibly damaging	Het
Rc3h2	T	C	2: 37,279,600 (GRCm39)	E543G	probably damaging	Het
Rimklb	G	A	6: 122,437,934 (GRCm39)	T103I	probably benign	Het
Samd4b	T	C	7: 28,113,662 (GRCm39)	Y101C	probably damaging	Het
Snrnp40	C	G	4: 130,271,836 (GRCm39)		probably null	Het
Tubgcp5	T	A	7: 55,479,086 (GRCm39)	S979T	probably damaging	Het
Vmn2r93	G	A	17: 18,546,311 (GRCm39)	E728K	probably damaging	Het
Wdr17	T	C	8: 55,146,087 (GRCm39)		probably benign	Het
Wdr90	T	C	17: 26,067,591 (GRCm39)	Y1457C	probably damaging	Het
Wsb1	T	C	11: 79,135,326 (GRCm39)	D225G	probably damaging	Het
Xirp2	T	C	2: 67,345,165 (GRCm39)	S2469P	possibly damaging	Het
Zeb1	T	A	18: 5,772,455 (GRCm39)	C915S	probably damaging	Het
Znfx1	C	A	2: 166,884,483 (GRCm39)	R923L	possibly damaging	Het

Other mutations in E2f4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:E2f4	APN	8	106,030,809 (GRCm39)	unclassified	probably benign
IGL01642:E2f4	APN	8	106,027,968 (GRCm39)	missense	probably damaging	1.00
R0534:E2f4	UTSW	8	106,030,851 (GRCm39)	missense	probably damaging	1.00
R0835:E2f4	UTSW	8	106,027,140 (GRCm39)	nonsense	probably null
R1548:E2f4	UTSW	8	106,031,320 (GRCm39)	makesense	probably null
R2120:E2f4	UTSW	8	106,026,973 (GRCm39)	missense	probably damaging	1.00
R2233:E2f4	UTSW	8	106,025,283 (GRCm39)	missense	probably damaging	1.00
R2235:E2f4	UTSW	8	106,025,283 (GRCm39)	missense	probably damaging	1.00
R7369:E2f4	UTSW	8	106,026,966 (GRCm39)	missense	probably benign	0.00
R7731:E2f4	UTSW	8	106,025,265 (GRCm39)	missense	probably damaging	0.99
R8265:E2f4	UTSW	8	106,027,977 (GRCm39)	missense	probably damaging	1.00
R8293:E2f4	UTSW	8	106,024,451 (GRCm39)	missense	probably damaging	0.98
R9283:E2f4	UTSW	8	106,024,395 (GRCm39)	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- ATCCAAGAACAGCATCCAGTGGAAG -3'
(R):5'- AGACCCAATGTTTCAGCCTATGCC -3'

Sequencing Primer
(F):5'- CATCCAGTGGAAGTGAGTGTG -3'
(R):5'- AATCTGACCAGGGGTTGC -3'

Posted On

2013-05-23