Incidental Mutation 'R5358:Igsf9'
ID424142
Institutional Source Beutler Lab
Gene Symbol Igsf9
Ensembl Gene ENSMUSG00000037995
Gene Nameimmunoglobulin superfamily, member 9
SynonymsNRT1, Dasm1
MMRRC Submission 042937-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5358 (G1)
Quality Score218
Status Not validated
Chromosome1
Chromosomal Location172481788-172498878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172484511 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 8 (T8I)
Ref Sequence ENSEMBL: ENSMUSP00000117854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052629] [ENSMUST00000111235] [ENSMUST00000127052] [ENSMUST00000127482] [ENSMUST00000135267]
Predicted Effect probably benign
Transcript: ENSMUST00000052629
AA Change: T8I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058275
Gene: ENSMUSG00000037995
AA Change: T8I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111235
AA Change: T8I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106866
Gene: ENSMUSG00000037995
AA Change: T8I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127052
AA Change: T8I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123401
Gene: ENSMUSG00000037995
AA Change: T8I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 26 109 6e-55 BLAST
SCOP:d1biha2 28 108 6e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127482
AA Change: T8I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000117854
Gene: ENSMUSG00000037995
AA Change: T8I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132141
Predicted Effect unknown
Transcript: ENSMUST00000135267
AA Change: T8I
SMART Domains Protein: ENSMUSP00000116948
Gene: ENSMUSG00000037995
AA Change: T8I

DomainStartEndE-ValueType
IG_like 4 68 3.29e1 SMART
IGc2 86 148 3.03e-12 SMART
low complexity region 156 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140814
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but show abnormal miniature inhibitory postsynaptic currents and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,013,331 V1842A probably damaging Het
Abi3 A T 11: 95,842,108 F13L probably benign Het
Adgre4 A G 17: 55,818,758 K538R probably benign Het
Bcas3 C T 11: 85,451,755 H191Y probably benign Het
Bicdl2 A G 17: 23,667,564 T376A probably benign Het
Ceacam18 C A 7: 43,637,073 N123K possibly damaging Het
Celsr3 C T 9: 108,832,025 R1357C possibly damaging Het
Chek2 T C 5: 110,841,282 probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Chrm2 A G 6: 36,523,355 K49R probably damaging Het
Daam1 T A 12: 71,952,459 L623* probably null Het
Ddx31 T A 2: 28,863,770 C448S probably damaging Het
Dnah7a A G 1: 53,547,172 S1507P probably damaging Het
Dnah8 C A 17: 30,746,954 T2420K probably damaging Het
Dyrk3 C T 1: 131,129,695 R247H probably damaging Het
Exoc4 A G 6: 33,265,999 E49G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam96b T C 8: 104,641,650 N14S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxj3 A G 4: 119,619,399 E258G probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Helz2 C T 2: 181,235,528 E1106K probably damaging Het
Hip1 G T 5: 135,436,398 S385R probably benign Het
Katnal2 A G 18: 77,017,494 Y86H possibly damaging Het
Kcnh6 A T 11: 106,027,591 I756F possibly damaging Het
Kdm5b C T 1: 134,607,694 R570* probably null Het
Kif16b T A 2: 142,740,969 R545S probably damaging Het
Kif21b T A 1: 136,172,292 I1528N possibly damaging Het
Kmt2a T C 9: 44,819,274 probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mknk2 T C 10: 80,671,763 T60A probably benign Het
Ncoa6 T C 2: 155,406,987 K1466E probably damaging Het
Ntsr2 A C 12: 16,654,082 T109P probably damaging Het
Nup214 C A 2: 32,017,146 S995Y unknown Het
Olfr448 A T 6: 42,896,520 Q23L probably benign Het
Pclo T A 5: 14,712,736 L456* probably null Het
Pde5a A G 3: 122,748,176 D105G probably damaging Het
Pik3c3 C A 18: 30,323,544 P709H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3c T C 13: 110,061,963 N179S possibly damaging Het
Setdb2 T A 14: 59,409,436 R559S probably benign Het
Sf3b1 A G 1: 55,003,310 Y474H probably benign Het
Slc6a6 G T 6: 91,735,174 W228L probably benign Het
Slc8a2 T G 7: 16,157,303 I750S probably damaging Het
Slco2b1 T A 7: 99,660,044 I194L unknown Het
Smarcd1 C T 15: 99,703,247 Q45* probably null Het
Srcap T G 7: 127,540,320 L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 N9Y probably damaging Het
St7 T C 6: 17,819,318 S74P probably damaging Het
Stxbp5l T A 16: 37,174,326 E739V probably damaging Het
Sun3 T A 11: 9,031,496 Q36L possibly damaging Het
Tbc1d32 T C 10: 56,170,937 H545R possibly damaging Het
Tcp11 A T 17: 28,078,020 C133S probably benign Het
Tm6sf2 T C 8: 70,074,289 V36A possibly damaging Het
Tmem108 T C 9: 103,499,518 Y244C probably damaging Het
Tra2a A T 6: 49,251,015 probably benign Het
Trpm3 A T 19: 22,925,968 I1031F probably damaging Het
Ttll3 A G 6: 113,401,331 K381E probably benign Het
Uaca T C 9: 60,871,148 V937A probably benign Het
Umod C T 7: 119,472,354 G388D probably damaging Het
Vmn2r90 G A 17: 17,704,150 probably null Het
Zfp644 G A 5: 106,635,675 T1002I probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Zfp738 A G 13: 67,671,012 Y287H probably damaging Het
Zfyve16 T C 13: 92,508,263 T1144A probably benign Het
Zgrf1 T C 3: 127,567,703 probably null Het
Other mutations in Igsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Igsf9 APN 1 172496636 missense probably benign
IGL01665:Igsf9 APN 1 172492171 nonsense probably null
IGL01808:Igsf9 APN 1 172484803 missense probably benign 0.03
IGL02480:Igsf9 APN 1 172496913 missense possibly damaging 0.88
IGL02480:Igsf9 APN 1 172484778 intron probably benign
IGL03087:Igsf9 APN 1 172490743 missense probably benign 0.00
R1258:Igsf9 UTSW 1 172492155 missense probably benign 0.02
R1419:Igsf9 UTSW 1 172498011 missense probably damaging 1.00
R2246:Igsf9 UTSW 1 172491649 missense probably benign 0.21
R2427:Igsf9 UTSW 1 172490739 missense probably damaging 0.98
R3900:Igsf9 UTSW 1 172489558 missense probably damaging 1.00
R4334:Igsf9 UTSW 1 172494212 nonsense probably null
R4831:Igsf9 UTSW 1 172491888 missense probably damaging 1.00
R4844:Igsf9 UTSW 1 172497170 missense probably benign 0.00
R4894:Igsf9 UTSW 1 172498067 missense probably benign 0.00
R5016:Igsf9 UTSW 1 172490712 missense probably damaging 1.00
R5705:Igsf9 UTSW 1 172494771 missense possibly damaging 0.80
R5762:Igsf9 UTSW 1 172498438 missense probably damaging 1.00
R6058:Igsf9 UTSW 1 172484889 missense probably damaging 1.00
R6510:Igsf9 UTSW 1 172490297 missense possibly damaging 0.78
R6821:Igsf9 UTSW 1 172484493 missense probably benign 0.39
R6822:Igsf9 UTSW 1 172497163 missense possibly damaging 0.95
R6829:Igsf9 UTSW 1 172495674 missense probably benign
R6848:Igsf9 UTSW 1 172495762 missense probably damaging 1.00
R6874:Igsf9 UTSW 1 172494529 missense probably benign
R7224:Igsf9 UTSW 1 172494782 missense probably damaging 1.00
R7284:Igsf9 UTSW 1 172496912 missense probably damaging 0.99
R7292:Igsf9 UTSW 1 172491757 critical splice donor site probably null
R7409:Igsf9 UTSW 1 172495274 missense probably benign
R7744:Igsf9 UTSW 1 172492185 missense probably benign 0.37
R7826:Igsf9 UTSW 1 172491630 missense probably benign 0.01
V7732:Igsf9 UTSW 1 172490393 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGTGAGCTAGGCACCAACTG -3'
(R):5'- GGAAGGCGTCATCAACATCTCTC -3'

Sequencing Primer
(F):5'- CTAGGCACCAACTGGAAGAGTG -3'
(R):5'- CCTTAAGACTTTGCACGATTGG -3'
Posted On2016-08-04