Incidental Mutation 'R5358:Tbc1d32'
ID424184
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene NameTBC1 domain family, member 32
SynonymsD630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission 042937-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R5358 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location56014293-56228689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56170937 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 545 (H545R)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099739
AA Change: H545R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: H545R

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,013,331 V1842A probably damaging Het
Abi3 A T 11: 95,842,108 F13L probably benign Het
Adgre4 A G 17: 55,818,758 K538R probably benign Het
Bcas3 C T 11: 85,451,755 H191Y probably benign Het
Bicdl2 A G 17: 23,667,564 T376A probably benign Het
Ceacam18 C A 7: 43,637,073 N123K possibly damaging Het
Celsr3 C T 9: 108,832,025 R1357C possibly damaging Het
Chek2 T C 5: 110,841,282 probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Chrm2 A G 6: 36,523,355 K49R probably damaging Het
Daam1 T A 12: 71,952,459 L623* probably null Het
Ddx31 T A 2: 28,863,770 C448S probably damaging Het
Dnah7a A G 1: 53,547,172 S1507P probably damaging Het
Dnah8 C A 17: 30,746,954 T2420K probably damaging Het
Dyrk3 C T 1: 131,129,695 R247H probably damaging Het
Exoc4 A G 6: 33,265,999 E49G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam96b T C 8: 104,641,650 N14S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxj3 A G 4: 119,619,399 E258G probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Helz2 C T 2: 181,235,528 E1106K probably damaging Het
Hip1 G T 5: 135,436,398 S385R probably benign Het
Igsf9 C T 1: 172,484,511 T8I probably benign Het
Katnal2 A G 18: 77,017,494 Y86H possibly damaging Het
Kcnh6 A T 11: 106,027,591 I756F possibly damaging Het
Kdm5b C T 1: 134,607,694 R570* probably null Het
Kif16b T A 2: 142,740,969 R545S probably damaging Het
Kif21b T A 1: 136,172,292 I1528N possibly damaging Het
Kmt2a T C 9: 44,819,274 probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mknk2 T C 10: 80,671,763 T60A probably benign Het
Ncoa6 T C 2: 155,406,987 K1466E probably damaging Het
Ntsr2 A C 12: 16,654,082 T109P probably damaging Het
Nup214 C A 2: 32,017,146 S995Y unknown Het
Olfr448 A T 6: 42,896,520 Q23L probably benign Het
Pclo T A 5: 14,712,736 L456* probably null Het
Pde5a A G 3: 122,748,176 D105G probably damaging Het
Pik3c3 C A 18: 30,323,544 P709H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3c T C 13: 110,061,963 N179S possibly damaging Het
Setdb2 T A 14: 59,409,436 R559S probably benign Het
Sf3b1 A G 1: 55,003,310 Y474H probably benign Het
Slc6a6 G T 6: 91,735,174 W228L probably benign Het
Slc8a2 T G 7: 16,157,303 I750S probably damaging Het
Slco2b1 T A 7: 99,660,044 I194L unknown Het
Smarcd1 C T 15: 99,703,247 Q45* probably null Het
Srcap T G 7: 127,540,320 L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 N9Y probably damaging Het
St7 T C 6: 17,819,318 S74P probably damaging Het
Stxbp5l T A 16: 37,174,326 E739V probably damaging Het
Sun3 T A 11: 9,031,496 Q36L possibly damaging Het
Tcp11 A T 17: 28,078,020 C133S probably benign Het
Tm6sf2 T C 8: 70,074,289 V36A possibly damaging Het
Tmem108 T C 9: 103,499,518 Y244C probably damaging Het
Tra2a A T 6: 49,251,015 probably benign Het
Trpm3 A T 19: 22,925,968 I1031F probably damaging Het
Ttll3 A G 6: 113,401,331 K381E probably benign Het
Uaca T C 9: 60,871,148 V937A probably benign Het
Umod C T 7: 119,472,354 G388D probably damaging Het
Vmn2r90 G A 17: 17,704,150 probably null Het
Zfp644 G A 5: 106,635,675 T1002I probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Zfp738 A G 13: 67,671,012 Y287H probably damaging Het
Zfyve16 T C 13: 92,508,263 T1144A probably benign Het
Zgrf1 T C 3: 127,567,703 probably null Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56224640 missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56177479 splice site probably benign
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56129093 missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56195475 missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56162208 missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56151811 nonsense probably null
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56151833 missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 56028077 missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56196592 missense not run
Z1188:Tbc1d32 UTSW 10 56170881 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATCTGGAATGATTGCTACTATC -3'
(R):5'- CCGGCATTTGTGAAGGTTTC -3'

Sequencing Primer
(F):5'- ACTCTCCAGGGATGTCTGAATGC -3'
(R):5'- TCTGTTGTTGTACTTGCGATATAAC -3'
Posted On2016-08-04