Incidental Mutation 'R5358:Tbc1d32'
ID 424184
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene Name TBC1 domain family, member 32
Synonyms D630037F22Rik, Bromi, b2b2284Clo, C6orf170
MMRRC Submission 042937-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R5358 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 55890389-56104785 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56047033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 545 (H545R)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
AlphaFold Q3URV1
Predicted Effect possibly damaging
Transcript: ENSMUST00000099739
AA Change: H545R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: H545R

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,849,165 (GRCm39) V1842A probably damaging Het
Abi3 A T 11: 95,732,934 (GRCm39) F13L probably benign Het
Adgre4 A G 17: 56,125,758 (GRCm39) K538R probably benign Het
Bcas3 C T 11: 85,342,581 (GRCm39) H191Y probably benign Het
Bicdl2 A G 17: 23,886,538 (GRCm39) T376A probably benign Het
Ceacam18 C A 7: 43,286,497 (GRCm39) N123K possibly damaging Het
Celsr3 C T 9: 108,709,224 (GRCm39) R1357C possibly damaging Het
Chek2 T C 5: 110,989,148 (GRCm39) probably benign Het
Chmp7 A G 14: 69,958,684 (GRCm39) V210A probably benign Het
Chrm2 A G 6: 36,500,290 (GRCm39) K49R probably damaging Het
Ciao2b T C 8: 105,368,282 (GRCm39) N14S probably damaging Het
Daam1 T A 12: 71,999,233 (GRCm39) L623* probably null Het
Ddx31 T A 2: 28,753,782 (GRCm39) C448S probably damaging Het
Dnah7a A G 1: 53,586,331 (GRCm39) S1507P probably damaging Het
Dnah8 C A 17: 30,965,928 (GRCm39) T2420K probably damaging Het
Dyrk3 C T 1: 131,057,432 (GRCm39) R247H probably damaging Het
Exoc4 A G 6: 33,242,934 (GRCm39) E49G probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Foxj3 A G 4: 119,476,596 (GRCm39) E258G probably damaging Het
Gata4 C T 14: 63,478,075 (GRCm39) A175T probably benign Het
Helz2 C T 2: 180,877,321 (GRCm39) E1106K probably damaging Het
Hip1 G T 5: 135,465,252 (GRCm39) S385R probably benign Het
Igsf9 C T 1: 172,312,078 (GRCm39) T8I probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Katnal2 A G 18: 77,105,190 (GRCm39) Y86H possibly damaging Het
Kcnh6 A T 11: 105,918,417 (GRCm39) I756F possibly damaging Het
Kdm5b C T 1: 134,535,432 (GRCm39) R570* probably null Het
Kif16b T A 2: 142,582,889 (GRCm39) R545S probably damaging Het
Kif21b T A 1: 136,100,030 (GRCm39) I1528N possibly damaging Het
Kmt2a T C 9: 44,730,571 (GRCm39) probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Melk C T 4: 44,363,730 (GRCm39) T592M probably damaging Het
Mknk2 T C 10: 80,507,597 (GRCm39) T60A probably benign Het
Ncoa6 T C 2: 155,248,907 (GRCm39) K1466E probably damaging Het
Ntsr2 A C 12: 16,704,083 (GRCm39) T109P probably damaging Het
Nup214 C A 2: 31,907,158 (GRCm39) S995Y unknown Het
Or2a5 A T 6: 42,873,454 (GRCm39) Q23L probably benign Het
Pclo T A 5: 14,762,750 (GRCm39) L456* probably null Het
Pde5a A G 3: 122,541,825 (GRCm39) D105G probably damaging Het
Pik3c3 C A 18: 30,456,597 (GRCm39) P709H probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rab3c T C 13: 110,198,497 (GRCm39) N179S possibly damaging Het
Setdb2 T A 14: 59,646,885 (GRCm39) R559S probably benign Het
Sf3b1 A G 1: 55,042,469 (GRCm39) Y474H probably benign Het
Slc6a6 G T 6: 91,712,155 (GRCm39) W228L probably benign Het
Slc8a2 T G 7: 15,891,228 (GRCm39) I750S probably damaging Het
Slco2b1 T A 7: 99,309,251 (GRCm39) I194L unknown Het
Smarcd1 C T 15: 99,601,128 (GRCm39) Q45* probably null Het
Srcap T G 7: 127,139,492 (GRCm39) L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 (GRCm39) N9Y probably damaging Het
St7 T C 6: 17,819,317 (GRCm39) S74P probably damaging Het
Stxbp5l T A 16: 36,994,688 (GRCm39) E739V probably damaging Het
Sun3 T A 11: 8,981,496 (GRCm39) Q36L possibly damaging Het
Tcp11 A T 17: 28,296,994 (GRCm39) C133S probably benign Het
Tm6sf2 T C 8: 70,526,939 (GRCm39) V36A possibly damaging Het
Tmem108 T C 9: 103,376,717 (GRCm39) Y244C probably damaging Het
Tra2a A T 6: 49,227,949 (GRCm39) probably benign Het
Trpm3 A T 19: 22,903,332 (GRCm39) I1031F probably damaging Het
Ttll3 A G 6: 113,378,292 (GRCm39) K381E probably benign Het
Uaca T C 9: 60,778,430 (GRCm39) V937A probably benign Het
Umod C T 7: 119,071,577 (GRCm39) G388D probably damaging Het
Vmn2r90 G A 17: 17,924,412 (GRCm39) probably null Het
Zbtb47 T A 9: 121,594,661 (GRCm39) F540Y probably damaging Het
Zfp644 G A 5: 106,783,541 (GRCm39) T1002I probably damaging Het
Zfp738 A G 13: 67,819,131 (GRCm39) Y287H probably damaging Het
Zfyve16 T C 13: 92,644,771 (GRCm39) T1144A probably benign Het
Zgrf1 T C 3: 127,361,352 (GRCm39) probably null Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56,031,861 (GRCm39) missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56,091,221 (GRCm39) splice site probably benign
IGL00835:Tbc1d32 APN 10 55,965,942 (GRCm39) splice site probably benign
IGL01013:Tbc1d32 APN 10 56,078,055 (GRCm39) splice site probably null
IGL01306:Tbc1d32 APN 10 56,056,620 (GRCm39) missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56,091,176 (GRCm39) missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 55,999,673 (GRCm39) missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56,027,871 (GRCm39) missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 55,964,499 (GRCm39) missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56,100,715 (GRCm39) missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56,074,638 (GRCm39) missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56,074,587 (GRCm39) missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 55,893,799 (GRCm39) missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56,056,620 (GRCm39) missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56,074,535 (GRCm39) missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 55,893,701 (GRCm39) missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56,068,994 (GRCm39) missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56,050,059 (GRCm39) missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56,100,736 (GRCm39) missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56,056,672 (GRCm39) missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56,037,243 (GRCm39) missense probably benign
R1432:Tbc1d32 UTSW 10 55,893,758 (GRCm39) missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56,053,575 (GRCm39) splice site probably benign
R1708:Tbc1d32 UTSW 10 56,027,865 (GRCm39) missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 55,893,700 (GRCm39) missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 55,999,633 (GRCm39) nonsense probably null
R2208:Tbc1d32 UTSW 10 56,026,888 (GRCm39) critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56,050,011 (GRCm39) missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56,005,189 (GRCm39) missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56,100,676 (GRCm39) missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 55,925,867 (GRCm39) missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56,047,000 (GRCm39) missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56,100,745 (GRCm39) missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56,072,932 (GRCm39) missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 55,925,125 (GRCm39) splice site probably null
R5031:Tbc1d32 UTSW 10 55,999,627 (GRCm39) missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56,071,500 (GRCm39) nonsense probably null
R5276:Tbc1d32 UTSW 10 56,027,914 (GRCm39) missense probably damaging 0.99
R5429:Tbc1d32 UTSW 10 55,904,089 (GRCm39) missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 55,916,246 (GRCm39) missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56,071,571 (GRCm39) missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56,005,246 (GRCm39) missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56,026,973 (GRCm39) missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 55,964,489 (GRCm39) missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56,091,158 (GRCm39) missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 55,964,433 (GRCm39) missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56,038,304 (GRCm39) missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56,026,979 (GRCm39) missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56,071,525 (GRCm39) missense probably benign
R6422:Tbc1d32 UTSW 10 55,904,157 (GRCm39) nonsense probably null
R6508:Tbc1d32 UTSW 10 56,100,786 (GRCm39) missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56,056,626 (GRCm39) missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56,027,907 (GRCm39) nonsense probably null
R7012:Tbc1d32 UTSW 10 56,100,820 (GRCm39) missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56,074,537 (GRCm39) missense probably benign
R7288:Tbc1d32 UTSW 10 55,927,483 (GRCm39) critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56,027,929 (GRCm39) missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 55,904,173 (GRCm39) missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56,072,688 (GRCm39) missense possibly damaging 0.93
R8864:Tbc1d32 UTSW 10 55,963,655 (GRCm39) missense probably benign 0.01
R9018:Tbc1d32 UTSW 10 55,948,693 (GRCm39) missense probably benign 0.02
R9030:Tbc1d32 UTSW 10 56,037,241 (GRCm39) missense possibly damaging 0.92
R9530:Tbc1d32 UTSW 10 56,072,507 (GRCm39) missense probably damaging 0.98
R9616:Tbc1d32 UTSW 10 56,037,246 (GRCm39) missense possibly damaging 0.85
Z1188:Tbc1d32 UTSW 10 56,046,977 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATCTGGAATGATTGCTACTATC -3'
(R):5'- CCGGCATTTGTGAAGGTTTC -3'

Sequencing Primer
(F):5'- ACTCTCCAGGGATGTCTGAATGC -3'
(R):5'- TCTGTTGTTGTACTTGCGATATAAC -3'
Posted On 2016-08-04