Mutagenetix > Incidental Mutation

Incidental Mutation 'R0488:Adam19'

42419

Institutional Source

Beutler Lab

Gene Symbol

Adam19

Ensembl Gene

ENSMUSG00000011256

Gene Name

a disintegrin and metallopeptidase domain 19 (meltrin beta)

Synonyms

Mltnb

MMRRC Submission

038687-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0488 (G1)

Quality Score

171

Status

Validated

Chromosome

Chromosomal Location

46055992-46147343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 46138930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 734 (L734R)

Ref Sequence

ENSEMBL: ENSMUSP00000011400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011400]

AlphaFold

O35674

Predicted Effect

probably damaging
Transcript: ENSMUST00000011400
AA Change: L734R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: L734R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	32	163	9.4e-27	PFAM
Pfam:Reprolysin_5	209	388	1.9e-25	PFAM
Pfam:Reprolysin_4	209	399	1.5e-15	PFAM
Pfam:Reprolysin	211	409	1.3e-68	PFAM
Pfam:Reprolysin_2	231	399	6.1e-19	PFAM
Pfam:Reprolysin_3	235	357	1.2e-19	PFAM
DISIN	426	501	9.7e-41	SMART
ACR	502	650	7.46e-62	SMART
transmembrane domain	704	726	N/A	INTRINSIC
low complexity region	788	797	N/A	INTRINSIC
low complexity region	832	846	N/A	INTRINSIC
low complexity region	886	905	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156446

Meta Mutation Damage Score

0.3429

Coding Region Coverage

1x: 99.7%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf1	T	C	17: 43,310,411	I513T	probably damaging	Het
Adgrl2	A	G	3: 148,846,905	V654A	probably damaging	Het
Agl	A	T	3: 116,754,962	Y1249*	probably null	Het
Ankar	T	A	1: 72,658,732	Q996H	probably damaging	Het
Aqp12	T	C	1: 93,008,656	Y235H	probably damaging	Het
Arsb	T	C	13: 93,940,505	V460A	probably benign	Het
Baiap3	A	G	17: 25,248,470		probably null	Het
Cd44	T	C	2: 102,834,219		probably benign	Het
Clec4b1	T	A	6: 123,071,482	I192N	probably damaging	Het
Cps1	A	C	1: 67,148,808		probably benign	Het
Dab2	T	C	15: 6,424,654	L215S	probably damaging	Het
E2f4	G	A	8: 105,298,539	V84I	probably damaging	Het
Edem2	T	C	2: 155,716,123	T197A	probably damaging	Het
Eno2	T	A	6: 124,763,874	M121L	probably benign	Het
Ephb1	A	G	9: 101,964,008	V757A	probably damaging	Het
Etv5	T	A	16: 22,412,945	I106F	probably damaging	Het
Foxj3	T	A	4: 119,619,990	Y298*	probably null	Het
Gm12185	A	G	11: 48,907,839	L609S	probably damaging	Het
Gm5884	T	C	6: 128,646,068		noncoding transcript	Het
Havcr1	A	G	11: 46,752,571	Y106C	probably damaging	Het
Jmjd1c	A	G	10: 67,240,727	N2110S	probably damaging	Het
Kif2b	T	C	11: 91,576,972	K162E	probably benign	Het
Micu2	T	C	14: 57,932,242	Y217C	probably benign	Het
Mink1	G	T	11: 70,597,204	G32C	probably damaging	Het
Mnat1	T	A	12: 73,170,639	N96K	probably damaging	Het
Mpp2	G	T	11: 102,061,601	R349S	possibly damaging	Het
Mrpl13	T	A	15: 55,539,148	I59F	probably benign	Het
Mybl2	T	C	2: 163,072,614		probably benign	Het
Otogl	T	C	10: 107,803,605	E1382G	probably benign	Het
Pclo	A	G	5: 14,669,299	E1150G	unknown	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Pla2g4a	G	A	1: 149,871,445	T322M	probably damaging	Het
Pramef6	A	T	4: 143,895,403	Y461N	probably benign	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Ptprg	A	T	14: 12,220,653	D455V	probably damaging	Het
Ptprt	T	C	2: 161,553,825	T1162A	probably damaging	Het
Rad51ap1	T	C	6: 126,934,760	N55D	possibly damaging	Het
Rc3h2	T	C	2: 37,389,588	E543G	probably damaging	Het
Rimklb	G	A	6: 122,460,975	T103I	probably benign	Het
Rsg1	A	G	4: 141,214,401	D14G	probably benign	Het
Samd4b	T	C	7: 28,414,237	Y101C	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tubgcp5	T	A	7: 55,829,338	S979T	probably damaging	Het
Vmn2r93	G	A	17: 18,326,049	E728K	probably damaging	Het
Wdr17	T	C	8: 54,693,052		probably benign	Het
Wdr90	T	C	17: 25,848,617	Y1457C	probably damaging	Het
Wsb1	T	C	11: 79,244,500	D225G	probably damaging	Het
Xirp2	T	C	2: 67,514,821	S2469P	possibly damaging	Het
Zeb1	T	A	18: 5,772,455	C915S	probably damaging	Het
Znfx1	C	A	2: 167,042,563	R923L	possibly damaging	Het

Other mutations in Adam19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Adam19	APN	11	46112783	missense	probably damaging	1.00
IGL01727:Adam19	APN	11	46121553	missense	probably benign
IGL01758:Adam19	APN	11	46112924	missense	probably benign	0.01
IGL02160:Adam19	APN	11	46139695	missense	probably damaging	0.99
IGL02421:Adam19	APN	11	46137553	missense	probably damaging	0.96
IGL02572:Adam19	APN	11	46131721	nonsense	probably null
IGL02995:Adam19	APN	11	46136349	missense	probably benign	0.00
IGL03171:Adam19	APN	11	46138854	missense	probably damaging	0.98
IGL03237:Adam19	APN	11	46137556	missense	probably benign
R0003:Adam19	UTSW	11	46128789	missense	probably damaging	1.00
R0026:Adam19	UTSW	11	46136259	missense	probably damaging	1.00
R0158:Adam19	UTSW	11	46143034	missense	probably damaging	1.00
R0304:Adam19	UTSW	11	46127392	missense	possibly damaging	0.91
R0501:Adam19	UTSW	11	46123130	missense	probably damaging	1.00
R0591:Adam19	UTSW	11	46121411	splice site	probably benign
R0734:Adam19	UTSW	11	46127403	missense	probably damaging	0.99
R0747:Adam19	UTSW	11	46118495	splice site	probably null
R0771:Adam19	UTSW	11	46121453	missense	possibly damaging	0.92
R1052:Adam19	UTSW	11	46127265	missense	probably damaging	0.99
R1573:Adam19	UTSW	11	46113618	splice site	probably benign
R1735:Adam19	UTSW	11	46138917	missense	probably benign	0.26
R1830:Adam19	UTSW	11	46127278	missense	probably damaging	0.98
R1911:Adam19	UTSW	11	46121454	missense	probably damaging	1.00
R2092:Adam19	UTSW	11	46060904	splice site	probably null
R3749:Adam19	UTSW	11	46137610	missense	probably benign	0.00
R3893:Adam19	UTSW	11	46128838	missense	probably damaging	1.00
R3916:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R3917:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R4506:Adam19	UTSW	11	46118444	missense	possibly damaging	0.67
R4767:Adam19	UTSW	11	46138977	critical splice donor site	probably null
R5055:Adam19	UTSW	11	46123169	missense	probably damaging	1.00
R5313:Adam19	UTSW	11	46131776	missense	probably damaging	1.00
R5329:Adam19	UTSW	11	46125026	missense	probably damaging	0.99
R5567:Adam19	UTSW	11	46136250	missense	probably damaging	1.00
R5602:Adam19	UTSW	11	46136315	missense	probably benign
R6198:Adam19	UTSW	11	46121502	missense	probably damaging	1.00
R6875:Adam19	UTSW	11	46112875	missense	probably benign
R7011:Adam19	UTSW	11	46143018	missense	probably benign	0.00
R7163:Adam19	UTSW	11	46131717	missense	probably benign
R7213:Adam19	UTSW	11	46121471	missense	probably benign	0.20
R7267:Adam19	UTSW	11	46121576	nonsense	probably null
R7896:Adam19	UTSW	11	46137543	missense	probably damaging	1.00
R8012:Adam19	UTSW	11	46065046	missense	possibly damaging	0.74
R8059:Adam19	UTSW	11	46136466	splice site	probably benign
R8243:Adam19	UTSW	11	46125082	missense	probably damaging	1.00
R8357:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R8419:Adam19	UTSW	11	46125023	missense	possibly damaging	0.77
R8457:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R9163:Adam19	UTSW	11	46127349	missense	probably benign	0.02
R9349:Adam19	UTSW	11	46131743	nonsense	probably null
R9489:Adam19	UTSW	11	46137622	missense	probably benign	0.10
R9579:Adam19	UTSW	11	46118435	missense	probably benign	0.00
R9641:Adam19	UTSW	11	46136322	missense	probably damaging	1.00
X0067:Adam19	UTSW	11	46056115	start codon destroyed	probably null	0.06

Predicted Primers

PCR Primer
(F):5'- TCGGCGGGAATCAAATACCTGGAG -3'
(R):5'- CCCCACTGGCATGGATAACAGAAG -3'

Sequencing Primer
(F):5'- GCGGAACAAAGGCTCTGTC -3'
(R):5'- aggctcagtagaaatcacttacag -3'

Posted On

2013-05-23