Incidental Mutation 'R5358:Abi3'
ID424194
Institutional Source Beutler Lab
Gene Symbol Abi3
Ensembl Gene ENSMUSG00000018381
Gene NameABI gene family, member 3
Synonyms
MMRRC Submission 042937-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5358 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location95830074-95842476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95842108 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 13 (F13L)
Ref Sequence ENSEMBL: ENSMUSP00000061893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036088] [ENSMUST00000059026] [ENSMUST00000100532] [ENSMUST00000107708] [ENSMUST00000107709] [ENSMUST00000107711] [ENSMUST00000107712] [ENSMUST00000107714]
Predicted Effect probably benign
Transcript: ENSMUST00000036088
SMART Domains Protein: ENSMUSP00000047586
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059026
AA Change: F13L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061893
Gene: ENSMUSG00000018381
AA Change: F13L

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Abi_HHR 96 168 4.3e-31 PFAM
low complexity region 206 225 N/A INTRINSIC
low complexity region 233 252 N/A INTRINSIC
low complexity region 259 303 N/A INTRINSIC
SH3 312 367 1.41e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100532
SMART Domains Protein: ENSMUSP00000098101
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107708
SMART Domains Protein: ENSMUSP00000103336
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107709
SMART Domains Protein: ENSMUSP00000103337
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107711
SMART Domains Protein: ENSMUSP00000103339
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107712
SMART Domains Protein: ENSMUSP00000103340
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107714
SMART Domains Protein: ENSMUSP00000103342
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143492
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,013,331 V1842A probably damaging Het
Adgre4 A G 17: 55,818,758 K538R probably benign Het
Bcas3 C T 11: 85,451,755 H191Y probably benign Het
Bicdl2 A G 17: 23,667,564 T376A probably benign Het
Ceacam18 C A 7: 43,637,073 N123K possibly damaging Het
Celsr3 C T 9: 108,832,025 R1357C possibly damaging Het
Chek2 T C 5: 110,841,282 probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Chrm2 A G 6: 36,523,355 K49R probably damaging Het
Daam1 T A 12: 71,952,459 L623* probably null Het
Ddx31 T A 2: 28,863,770 C448S probably damaging Het
Dnah7a A G 1: 53,547,172 S1507P probably damaging Het
Dnah8 C A 17: 30,746,954 T2420K probably damaging Het
Dyrk3 C T 1: 131,129,695 R247H probably damaging Het
Exoc4 A G 6: 33,265,999 E49G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam96b T C 8: 104,641,650 N14S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxj3 A G 4: 119,619,399 E258G probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Helz2 C T 2: 181,235,528 E1106K probably damaging Het
Hip1 G T 5: 135,436,398 S385R probably benign Het
Igsf9 C T 1: 172,484,511 T8I probably benign Het
Katnal2 A G 18: 77,017,494 Y86H possibly damaging Het
Kcnh6 A T 11: 106,027,591 I756F possibly damaging Het
Kdm5b C T 1: 134,607,694 R570* probably null Het
Kif16b T A 2: 142,740,969 R545S probably damaging Het
Kif21b T A 1: 136,172,292 I1528N possibly damaging Het
Kmt2a T C 9: 44,819,274 probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mknk2 T C 10: 80,671,763 T60A probably benign Het
Ncoa6 T C 2: 155,406,987 K1466E probably damaging Het
Ntsr2 A C 12: 16,654,082 T109P probably damaging Het
Nup214 C A 2: 32,017,146 S995Y unknown Het
Olfr448 A T 6: 42,896,520 Q23L probably benign Het
Pclo T A 5: 14,712,736 L456* probably null Het
Pde5a A G 3: 122,748,176 D105G probably damaging Het
Pik3c3 C A 18: 30,323,544 P709H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3c T C 13: 110,061,963 N179S possibly damaging Het
Setdb2 T A 14: 59,409,436 R559S probably benign Het
Sf3b1 A G 1: 55,003,310 Y474H probably benign Het
Slc6a6 G T 6: 91,735,174 W228L probably benign Het
Slc8a2 T G 7: 16,157,303 I750S probably damaging Het
Slco2b1 T A 7: 99,660,044 I194L unknown Het
Smarcd1 C T 15: 99,703,247 Q45* probably null Het
Srcap T G 7: 127,540,320 L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 N9Y probably damaging Het
St7 T C 6: 17,819,318 S74P probably damaging Het
Stxbp5l T A 16: 37,174,326 E739V probably damaging Het
Sun3 T A 11: 9,031,496 Q36L possibly damaging Het
Tbc1d32 T C 10: 56,170,937 H545R possibly damaging Het
Tcp11 A T 17: 28,078,020 C133S probably benign Het
Tm6sf2 T C 8: 70,074,289 V36A possibly damaging Het
Tmem108 T C 9: 103,499,518 Y244C probably damaging Het
Tra2a A T 6: 49,251,015 probably benign Het
Trpm3 A T 19: 22,925,968 I1031F probably damaging Het
Ttll3 A G 6: 113,401,331 K381E probably benign Het
Uaca T C 9: 60,871,148 V937A probably benign Het
Umod C T 7: 119,472,354 G388D probably damaging Het
Vmn2r90 G A 17: 17,704,150 probably null Het
Zfp644 G A 5: 106,635,675 T1002I probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Zfp738 A G 13: 67,671,012 Y287H probably damaging Het
Zfyve16 T C 13: 92,508,263 T1144A probably benign Het
Zgrf1 T C 3: 127,567,703 probably null Het
Other mutations in Abi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Abi3 APN 11 95835799 missense probably damaging 1.00
R0045:Abi3 UTSW 11 95832715 makesense probably null
R0626:Abi3 UTSW 11 95837111 missense probably benign 0.28
R0690:Abi3 UTSW 11 95833634 unclassified probably benign
R4653:Abi3 UTSW 11 95832811 missense probably benign 0.34
R5881:Abi3 UTSW 11 95834387 missense probably damaging 1.00
R5881:Abi3 UTSW 11 95834388 missense probably damaging 1.00
R6020:Abi3 UTSW 11 95842025 nonsense probably null
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6130:Abi3 UTSW 11 95837095 missense probably damaging 1.00
R6388:Abi3 UTSW 11 95833638 critical splice donor site probably null
R6963:Abi3 UTSW 11 95832741 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTGAAGATTGCTCAGCCAAGG -3'
(R):5'- CTTGTCCCGGAATGAGCATG -3'

Sequencing Primer
(F):5'- GCTCAGCCAAGGCAGGAAC -3'
(R):5'- GAGCATGCCTACCCCTTTACAGG -3'
Posted On2016-08-04