Incidental Mutation 'R5358:Ntsr2'
ID424196
Institutional Source Beutler Lab
Gene Symbol Ntsr2
Ensembl Gene ENSMUSG00000020591
Gene Nameneurotensin receptor 2
SynonymsNTRL, NT2R
MMRRC Submission 042937-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5358 (G1)
Quality Score194
Status Not validated
Chromosome12
Chromosomal Location16653382-16660227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 16654082 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 109 (T109P)
Ref Sequence ENSEMBL: ENSMUSP00000152592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111064] [ENSMUST00000220892] [ENSMUST00000221049] [ENSMUST00000221596]
Predicted Effect probably damaging
Transcript: ENSMUST00000111064
AA Change: T195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106693
Gene: ENSMUSG00000020591
AA Change: T195P

DomainStartEndE-ValueType
Pfam:7tm_1 49 358 4.2e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220892
AA Change: T195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000221049
AA Change: T109P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221596
AA Change: T195P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222957
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit abnormal thermal nociception. Mice homozygous for different knock-out allele exhibit increased prepulse inhibition and decreased accoustic startle response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,013,331 V1842A probably damaging Het
Abi3 A T 11: 95,842,108 F13L probably benign Het
Adgre4 A G 17: 55,818,758 K538R probably benign Het
Bcas3 C T 11: 85,451,755 H191Y probably benign Het
Bicdl2 A G 17: 23,667,564 T376A probably benign Het
Ceacam18 C A 7: 43,637,073 N123K possibly damaging Het
Celsr3 C T 9: 108,832,025 R1357C possibly damaging Het
Chek2 T C 5: 110,841,282 probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Chrm2 A G 6: 36,523,355 K49R probably damaging Het
Daam1 T A 12: 71,952,459 L623* probably null Het
Ddx31 T A 2: 28,863,770 C448S probably damaging Het
Dnah7a A G 1: 53,547,172 S1507P probably damaging Het
Dnah8 C A 17: 30,746,954 T2420K probably damaging Het
Dyrk3 C T 1: 131,129,695 R247H probably damaging Het
Exoc4 A G 6: 33,265,999 E49G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam96b T C 8: 104,641,650 N14S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxj3 A G 4: 119,619,399 E258G probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Helz2 C T 2: 181,235,528 E1106K probably damaging Het
Hip1 G T 5: 135,436,398 S385R probably benign Het
Igsf9 C T 1: 172,484,511 T8I probably benign Het
Katnal2 A G 18: 77,017,494 Y86H possibly damaging Het
Kcnh6 A T 11: 106,027,591 I756F possibly damaging Het
Kdm5b C T 1: 134,607,694 R570* probably null Het
Kif16b T A 2: 142,740,969 R545S probably damaging Het
Kif21b T A 1: 136,172,292 I1528N possibly damaging Het
Kmt2a T C 9: 44,819,274 probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mknk2 T C 10: 80,671,763 T60A probably benign Het
Ncoa6 T C 2: 155,406,987 K1466E probably damaging Het
Nup214 C A 2: 32,017,146 S995Y unknown Het
Olfr448 A T 6: 42,896,520 Q23L probably benign Het
Pclo T A 5: 14,712,736 L456* probably null Het
Pde5a A G 3: 122,748,176 D105G probably damaging Het
Pik3c3 C A 18: 30,323,544 P709H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3c T C 13: 110,061,963 N179S possibly damaging Het
Setdb2 T A 14: 59,409,436 R559S probably benign Het
Sf3b1 A G 1: 55,003,310 Y474H probably benign Het
Slc6a6 G T 6: 91,735,174 W228L probably benign Het
Slc8a2 T G 7: 16,157,303 I750S probably damaging Het
Slco2b1 T A 7: 99,660,044 I194L unknown Het
Smarcd1 C T 15: 99,703,247 Q45* probably null Het
Srcap T G 7: 127,540,320 L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 N9Y probably damaging Het
St7 T C 6: 17,819,318 S74P probably damaging Het
Stxbp5l T A 16: 37,174,326 E739V probably damaging Het
Sun3 T A 11: 9,031,496 Q36L possibly damaging Het
Tbc1d32 T C 10: 56,170,937 H545R possibly damaging Het
Tcp11 A T 17: 28,078,020 C133S probably benign Het
Tm6sf2 T C 8: 70,074,289 V36A possibly damaging Het
Tmem108 T C 9: 103,499,518 Y244C probably damaging Het
Tra2a A T 6: 49,251,015 probably benign Het
Trpm3 A T 19: 22,925,968 I1031F probably damaging Het
Ttll3 A G 6: 113,401,331 K381E probably benign Het
Uaca T C 9: 60,871,148 V937A probably benign Het
Umod C T 7: 119,472,354 G388D probably damaging Het
Vmn2r90 G A 17: 17,704,150 probably null Het
Zfp644 G A 5: 106,635,675 T1002I probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Zfp738 A G 13: 67,671,012 Y287H probably damaging Het
Zfyve16 T C 13: 92,508,263 T1144A probably benign Het
Zgrf1 T C 3: 127,567,703 probably null Het
Other mutations in Ntsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Ntsr2 APN 12 16659848 missense probably damaging 0.97
IGL01973:Ntsr2 APN 12 16656774 missense probably benign 0.01
IGL02202:Ntsr2 APN 12 16653660 missense probably damaging 0.99
IGL02493:Ntsr2 APN 12 16658389 missense possibly damaging 0.90
IGL02837:Ntsr2 UTSW 12 16653875 missense probably damaging 0.99
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0381:Ntsr2 UTSW 12 16659718 nonsense probably null
R0437:Ntsr2 UTSW 12 16653695 missense probably damaging 1.00
R0666:Ntsr2 UTSW 12 16653980 missense probably benign 0.28
R0751:Ntsr2 UTSW 12 16654030 missense probably damaging 1.00
R1919:Ntsr2 UTSW 12 16654110 missense probably damaging 0.96
R2190:Ntsr2 UTSW 12 16654017 missense probably damaging 1.00
R5323:Ntsr2 UTSW 12 16659933 missense probably benign 0.00
R6282:Ntsr2 UTSW 12 16658425 missense probably damaging 1.00
R6358:Ntsr2 UTSW 12 16656768 missense probably benign 0.29
R6523:Ntsr2 UTSW 12 16656696 missense probably benign 0.05
R6837:Ntsr2 UTSW 12 16659709 missense probably benign 0.04
R8396:Ntsr2 UTSW 12 16656820 missense probably damaging 1.00
RF017:Ntsr2 UTSW 12 16659765 missense probably damaging 0.99
X0064:Ntsr2 UTSW 12 16656757 missense probably damaging 1.00
Z1177:Ntsr2 UTSW 12 16653662 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCGTGGCTATTACTTCGTGC -3'
(R):5'- ACCCTGGAGGAGTTGCTTTAG -3'

Sequencing Primer
(F):5'- TGAGCTGTGCGCCTACG -3'
(R):5'- GGAGTTGCTTTAGTTTCTTTCACTAC -3'
Posted On2016-08-04