Incidental Mutation 'R5358:Daam1'
ID424197
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission 042937-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5358 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 71952459 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 623 (L623*)
Ref Sequence ENSEMBL: ENSMUSP00000152564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect probably null
Transcript: ENSMUST00000085299
AA Change: L623*
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: L623*

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably null
Transcript: ENSMUST00000221317
AA Change: L623*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222327
Predicted Effect probably null
Transcript: ENSMUST00000223272
AA Change: L623*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,013,331 V1842A probably damaging Het
Abi3 A T 11: 95,842,108 F13L probably benign Het
Adgre4 A G 17: 55,818,758 K538R probably benign Het
Bcas3 C T 11: 85,451,755 H191Y probably benign Het
Bicdl2 A G 17: 23,667,564 T376A probably benign Het
Ceacam18 C A 7: 43,637,073 N123K possibly damaging Het
Celsr3 C T 9: 108,832,025 R1357C possibly damaging Het
Chek2 T C 5: 110,841,282 probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Chrm2 A G 6: 36,523,355 K49R probably damaging Het
Ddx31 T A 2: 28,863,770 C448S probably damaging Het
Dnah7a A G 1: 53,547,172 S1507P probably damaging Het
Dnah8 C A 17: 30,746,954 T2420K probably damaging Het
Dyrk3 C T 1: 131,129,695 R247H probably damaging Het
Exoc4 A G 6: 33,265,999 E49G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam96b T C 8: 104,641,650 N14S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxj3 A G 4: 119,619,399 E258G probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Helz2 C T 2: 181,235,528 E1106K probably damaging Het
Hip1 G T 5: 135,436,398 S385R probably benign Het
Igsf9 C T 1: 172,484,511 T8I probably benign Het
Katnal2 A G 18: 77,017,494 Y86H possibly damaging Het
Kcnh6 A T 11: 106,027,591 I756F possibly damaging Het
Kdm5b C T 1: 134,607,694 R570* probably null Het
Kif16b T A 2: 142,740,969 R545S probably damaging Het
Kif21b T A 1: 136,172,292 I1528N possibly damaging Het
Kmt2a T C 9: 44,819,274 probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mknk2 T C 10: 80,671,763 T60A probably benign Het
Ncoa6 T C 2: 155,406,987 K1466E probably damaging Het
Ntsr2 A C 12: 16,654,082 T109P probably damaging Het
Nup214 C A 2: 32,017,146 S995Y unknown Het
Olfr448 A T 6: 42,896,520 Q23L probably benign Het
Pclo T A 5: 14,712,736 L456* probably null Het
Pde5a A G 3: 122,748,176 D105G probably damaging Het
Pik3c3 C A 18: 30,323,544 P709H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3c T C 13: 110,061,963 N179S possibly damaging Het
Setdb2 T A 14: 59,409,436 R559S probably benign Het
Sf3b1 A G 1: 55,003,310 Y474H probably benign Het
Slc6a6 G T 6: 91,735,174 W228L probably benign Het
Slc8a2 T G 7: 16,157,303 I750S probably damaging Het
Slco2b1 T A 7: 99,660,044 I194L unknown Het
Smarcd1 C T 15: 99,703,247 Q45* probably null Het
Srcap T G 7: 127,540,320 L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 N9Y probably damaging Het
St7 T C 6: 17,819,318 S74P probably damaging Het
Stxbp5l T A 16: 37,174,326 E739V probably damaging Het
Sun3 T A 11: 9,031,496 Q36L possibly damaging Het
Tbc1d32 T C 10: 56,170,937 H545R possibly damaging Het
Tcp11 A T 17: 28,078,020 C133S probably benign Het
Tm6sf2 T C 8: 70,074,289 V36A possibly damaging Het
Tmem108 T C 9: 103,499,518 Y244C probably damaging Het
Tra2a A T 6: 49,251,015 probably benign Het
Trpm3 A T 19: 22,925,968 I1031F probably damaging Het
Ttll3 A G 6: 113,401,331 K381E probably benign Het
Uaca T C 9: 60,871,148 V937A probably benign Het
Umod C T 7: 119,472,354 G388D probably damaging Het
Vmn2r90 G A 17: 17,704,150 probably null Het
Zfp644 G A 5: 106,635,675 T1002I probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Zfp738 A G 13: 67,671,012 Y287H probably damaging Het
Zfyve16 T C 13: 92,508,263 T1144A probably benign Het
Zgrf1 T C 3: 127,567,703 probably null Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCAGCTCCTATGTTAGTTGAC -3'
(R):5'- TGCTTTACAGGAACGCCTTG -3'

Sequencing Primer
(F):5'- CAGCTCCTATGTTAGTTGACAATGTC -3'
(R):5'- TTTACAGGAACGCCTTGGGGAG -3'
Posted On2016-08-04