Incidental Mutation 'R5358:Setdb2'
ID 424202
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission 042937-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R5358 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59646885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 559 (R559S)
Ref Sequence ENSEMBL: ENSMUSP00000093450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably benign
Transcript: ENSMUST00000095775
AA Change: R559S

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: R559S

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159640
Predicted Effect probably benign
Transcript: ENSMUST00000161459
AA Change: R543S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: R543S

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161959
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,849,165 (GRCm39) V1842A probably damaging Het
Abi3 A T 11: 95,732,934 (GRCm39) F13L probably benign Het
Adgre4 A G 17: 56,125,758 (GRCm39) K538R probably benign Het
Bcas3 C T 11: 85,342,581 (GRCm39) H191Y probably benign Het
Bicdl2 A G 17: 23,886,538 (GRCm39) T376A probably benign Het
Ceacam18 C A 7: 43,286,497 (GRCm39) N123K possibly damaging Het
Celsr3 C T 9: 108,709,224 (GRCm39) R1357C possibly damaging Het
Chek2 T C 5: 110,989,148 (GRCm39) probably benign Het
Chmp7 A G 14: 69,958,684 (GRCm39) V210A probably benign Het
Chrm2 A G 6: 36,500,290 (GRCm39) K49R probably damaging Het
Ciao2b T C 8: 105,368,282 (GRCm39) N14S probably damaging Het
Daam1 T A 12: 71,999,233 (GRCm39) L623* probably null Het
Ddx31 T A 2: 28,753,782 (GRCm39) C448S probably damaging Het
Dnah7a A G 1: 53,586,331 (GRCm39) S1507P probably damaging Het
Dnah8 C A 17: 30,965,928 (GRCm39) T2420K probably damaging Het
Dyrk3 C T 1: 131,057,432 (GRCm39) R247H probably damaging Het
Exoc4 A G 6: 33,242,934 (GRCm39) E49G probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Foxj3 A G 4: 119,476,596 (GRCm39) E258G probably damaging Het
Gata4 C T 14: 63,478,075 (GRCm39) A175T probably benign Het
Helz2 C T 2: 180,877,321 (GRCm39) E1106K probably damaging Het
Hip1 G T 5: 135,465,252 (GRCm39) S385R probably benign Het
Igsf9 C T 1: 172,312,078 (GRCm39) T8I probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Katnal2 A G 18: 77,105,190 (GRCm39) Y86H possibly damaging Het
Kcnh6 A T 11: 105,918,417 (GRCm39) I756F possibly damaging Het
Kdm5b C T 1: 134,535,432 (GRCm39) R570* probably null Het
Kif16b T A 2: 142,582,889 (GRCm39) R545S probably damaging Het
Kif21b T A 1: 136,100,030 (GRCm39) I1528N possibly damaging Het
Kmt2a T C 9: 44,730,571 (GRCm39) probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Melk C T 4: 44,363,730 (GRCm39) T592M probably damaging Het
Mknk2 T C 10: 80,507,597 (GRCm39) T60A probably benign Het
Ncoa6 T C 2: 155,248,907 (GRCm39) K1466E probably damaging Het
Ntsr2 A C 12: 16,704,083 (GRCm39) T109P probably damaging Het
Nup214 C A 2: 31,907,158 (GRCm39) S995Y unknown Het
Or2a5 A T 6: 42,873,454 (GRCm39) Q23L probably benign Het
Pclo T A 5: 14,762,750 (GRCm39) L456* probably null Het
Pde5a A G 3: 122,541,825 (GRCm39) D105G probably damaging Het
Pik3c3 C A 18: 30,456,597 (GRCm39) P709H probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rab3c T C 13: 110,198,497 (GRCm39) N179S possibly damaging Het
Sf3b1 A G 1: 55,042,469 (GRCm39) Y474H probably benign Het
Slc6a6 G T 6: 91,712,155 (GRCm39) W228L probably benign Het
Slc8a2 T G 7: 15,891,228 (GRCm39) I750S probably damaging Het
Slco2b1 T A 7: 99,309,251 (GRCm39) I194L unknown Het
Smarcd1 C T 15: 99,601,128 (GRCm39) Q45* probably null Het
Srcap T G 7: 127,139,492 (GRCm39) L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 (GRCm39) N9Y probably damaging Het
St7 T C 6: 17,819,317 (GRCm39) S74P probably damaging Het
Stxbp5l T A 16: 36,994,688 (GRCm39) E739V probably damaging Het
Sun3 T A 11: 8,981,496 (GRCm39) Q36L possibly damaging Het
Tbc1d32 T C 10: 56,047,033 (GRCm39) H545R possibly damaging Het
Tcp11 A T 17: 28,296,994 (GRCm39) C133S probably benign Het
Tm6sf2 T C 8: 70,526,939 (GRCm39) V36A possibly damaging Het
Tmem108 T C 9: 103,376,717 (GRCm39) Y244C probably damaging Het
Tra2a A T 6: 49,227,949 (GRCm39) probably benign Het
Trpm3 A T 19: 22,903,332 (GRCm39) I1031F probably damaging Het
Ttll3 A G 6: 113,378,292 (GRCm39) K381E probably benign Het
Uaca T C 9: 60,778,430 (GRCm39) V937A probably benign Het
Umod C T 7: 119,071,577 (GRCm39) G388D probably damaging Het
Vmn2r90 G A 17: 17,924,412 (GRCm39) probably null Het
Zbtb47 T A 9: 121,594,661 (GRCm39) F540Y probably damaging Het
Zfp644 G A 5: 106,783,541 (GRCm39) T1002I probably damaging Het
Zfp738 A G 13: 67,819,131 (GRCm39) Y287H probably damaging Het
Zfyve16 T C 13: 92,644,771 (GRCm39) T1144A probably benign Het
Zgrf1 T C 3: 127,361,352 (GRCm39) probably null Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0610:Setdb2 UTSW 14 59,654,919 (GRCm39) missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R3919:Setdb2 UTSW 14 59,656,616 (GRCm39) missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59,663,943 (GRCm39) missense probably null 0.00
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59,646,981 (GRCm39) splice site probably null
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59,656,700 (GRCm39) missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R7759:Setdb2 UTSW 14 59,656,813 (GRCm39) missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59,651,141 (GRCm39) splice site probably benign
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59,646,841 (GRCm39) missense probably benign 0.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTACTGAGCTGCATCAGG -3'
(R):5'- CTGCCTACCTTAACATTTGGTAAAG -3'

Sequencing Primer
(F):5'- GAAGCAGATGGAATCTTTGTCCTCTC -3'
(R):5'- CCTTAACATTTGGTAAAGATTACTGC -3'
Posted On 2016-08-04