Incidental Mutation 'R5358:Smarcd1'
ID424205
Institutional Source Beutler Lab
Gene Symbol Smarcd1
Ensembl Gene ENSMUSG00000023018
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
SynonymsD15Kz1, Baf60a
MMRRC Submission 042937-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R5358 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99702129-99713991 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 99703247 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 45 (Q45*)
Ref Sequence ENSEMBL: ENSMUSP00000155619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000023759] [ENSMUST00000163472] [ENSMUST00000228185] [ENSMUST00000228984] [ENSMUST00000229236] [ENSMUST00000229845] [ENSMUST00000230530]
Predicted Effect probably benign
Transcript: ENSMUST00000023758
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000023759
AA Change: Q107*
SMART Domains Protein: ENSMUSP00000023759
Gene: ENSMUSG00000023018
AA Change: Q107*

DomainStartEndE-ValueType
low complexity region 9 38 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Blast:KISc 124 271 2e-43 BLAST
SWIB 291 370 1.97e-35 SMART
Blast:MYSc 452 498 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163472
SMART Domains Protein: ENSMUSP00000128823
Gene: ENSMUSG00000091604

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
low complexity region 44 78 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227670
Predicted Effect probably benign
Transcript: ENSMUST00000228185
Predicted Effect probably null
Transcript: ENSMUST00000228984
AA Change: Q45*
Predicted Effect probably null
Transcript: ENSMUST00000229236
AA Change: Q107*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229686
Predicted Effect probably null
Transcript: ENSMUST00000229845
AA Change: Q45*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230504
Predicted Effect probably null
Transcript: ENSMUST00000230530
AA Change: Q45*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230748
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,013,331 V1842A probably damaging Het
Abi3 A T 11: 95,842,108 F13L probably benign Het
Adgre4 A G 17: 55,818,758 K538R probably benign Het
Bcas3 C T 11: 85,451,755 H191Y probably benign Het
Bicdl2 A G 17: 23,667,564 T376A probably benign Het
Ceacam18 C A 7: 43,637,073 N123K possibly damaging Het
Celsr3 C T 9: 108,832,025 R1357C possibly damaging Het
Chek2 T C 5: 110,841,282 probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Chrm2 A G 6: 36,523,355 K49R probably damaging Het
Daam1 T A 12: 71,952,459 L623* probably null Het
Ddx31 T A 2: 28,863,770 C448S probably damaging Het
Dnah7a A G 1: 53,547,172 S1507P probably damaging Het
Dnah8 C A 17: 30,746,954 T2420K probably damaging Het
Dyrk3 C T 1: 131,129,695 R247H probably damaging Het
Exoc4 A G 6: 33,265,999 E49G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam96b T C 8: 104,641,650 N14S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxj3 A G 4: 119,619,399 E258G probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Helz2 C T 2: 181,235,528 E1106K probably damaging Het
Hip1 G T 5: 135,436,398 S385R probably benign Het
Igsf9 C T 1: 172,484,511 T8I probably benign Het
Katnal2 A G 18: 77,017,494 Y86H possibly damaging Het
Kcnh6 A T 11: 106,027,591 I756F possibly damaging Het
Kdm5b C T 1: 134,607,694 R570* probably null Het
Kif16b T A 2: 142,740,969 R545S probably damaging Het
Kif21b T A 1: 136,172,292 I1528N possibly damaging Het
Kmt2a T C 9: 44,819,274 probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mknk2 T C 10: 80,671,763 T60A probably benign Het
Ncoa6 T C 2: 155,406,987 K1466E probably damaging Het
Ntsr2 A C 12: 16,654,082 T109P probably damaging Het
Nup214 C A 2: 32,017,146 S995Y unknown Het
Olfr448 A T 6: 42,896,520 Q23L probably benign Het
Pclo T A 5: 14,712,736 L456* probably null Het
Pde5a A G 3: 122,748,176 D105G probably damaging Het
Pik3c3 C A 18: 30,323,544 P709H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3c T C 13: 110,061,963 N179S possibly damaging Het
Setdb2 T A 14: 59,409,436 R559S probably benign Het
Sf3b1 A G 1: 55,003,310 Y474H probably benign Het
Slc6a6 G T 6: 91,735,174 W228L probably benign Het
Slc8a2 T G 7: 16,157,303 I750S probably damaging Het
Slco2b1 T A 7: 99,660,044 I194L unknown Het
Srcap T G 7: 127,540,320 L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 N9Y probably damaging Het
St7 T C 6: 17,819,318 S74P probably damaging Het
Stxbp5l T A 16: 37,174,326 E739V probably damaging Het
Sun3 T A 11: 9,031,496 Q36L possibly damaging Het
Tbc1d32 T C 10: 56,170,937 H545R possibly damaging Het
Tcp11 A T 17: 28,078,020 C133S probably benign Het
Tm6sf2 T C 8: 70,074,289 V36A possibly damaging Het
Tmem108 T C 9: 103,499,518 Y244C probably damaging Het
Tra2a A T 6: 49,251,015 probably benign Het
Trpm3 A T 19: 22,925,968 I1031F probably damaging Het
Ttll3 A G 6: 113,401,331 K381E probably benign Het
Uaca T C 9: 60,871,148 V937A probably benign Het
Umod C T 7: 119,472,354 G388D probably damaging Het
Vmn2r90 G A 17: 17,704,150 probably null Het
Zfp644 G A 5: 106,635,675 T1002I probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Zfp738 A G 13: 67,671,012 Y287H probably damaging Het
Zfyve16 T C 13: 92,508,263 T1144A probably benign Het
Zgrf1 T C 3: 127,567,703 probably null Het
Other mutations in Smarcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Smarcd1 APN 15 99712213 missense probably benign 0.10
IGL01714:Smarcd1 APN 15 99712421 missense probably damaging 1.00
IGL02488:Smarcd1 APN 15 99711201 missense possibly damaging 0.83
P0021:Smarcd1 UTSW 15 99712361 splice site probably benign
R0597:Smarcd1 UTSW 15 99711094 missense probably damaging 1.00
R0645:Smarcd1 UTSW 15 99707386 unclassified probably null
R1531:Smarcd1 UTSW 15 99707383 missense probably damaging 1.00
R1661:Smarcd1 UTSW 15 99707638 critical splice acceptor site probably null
R1857:Smarcd1 UTSW 15 99709414 missense probably damaging 0.97
R3003:Smarcd1 UTSW 15 99712184 missense probably damaging 1.00
R4170:Smarcd1 UTSW 15 99707931 missense probably damaging 1.00
R4964:Smarcd1 UTSW 15 99707981 missense possibly damaging 0.79
R5116:Smarcd1 UTSW 15 99702488 missense probably benign 0.00
R5559:Smarcd1 UTSW 15 99703295 critical splice donor site probably null
R6026:Smarcd1 UTSW 15 99705738 missense probably damaging 1.00
R6424:Smarcd1 UTSW 15 99704367 missense probably damaging 1.00
R6450:Smarcd1 UTSW 15 99707885 missense possibly damaging 0.85
R7126:Smarcd1 UTSW 15 99709325 missense probably damaging 1.00
X0026:Smarcd1 UTSW 15 99702449 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGTATGACATTTCTGGGTCCTC -3'
(R):5'- AAGACGCTACCTCTCCCATG -3'

Sequencing Primer
(F):5'- CTCCCTTCTGTAGAGACCAGGTATG -3'
(R):5'- ACTGCATCATGAGGCCCTGTTAG -3'
Posted On2016-08-04