Incidental Mutation 'R5358:Katnal2'
ID424214
Institutional Source Beutler Lab
Gene Symbol Katnal2
Ensembl Gene ENSMUSG00000025420
Gene Namekatanin p60 subunit A-like 2
Synonyms4933439B08Rik, 3110023G01Rik
MMRRC Submission 042937-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5358 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location76977148-77047308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77017494 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 86 (Y86H)
Ref Sequence ENSEMBL: ENSMUSP00000115411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026486] [ENSMUST00000122984] [ENSMUST00000123650] [ENSMUST00000126153] [ENSMUST00000135029] [ENSMUST00000137354] [ENSMUST00000137498] [ENSMUST00000154665]
Predicted Effect probably benign
Transcript: ENSMUST00000026486
AA Change: Y86H

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026486
Gene: ENSMUSG00000025420
AA Change: Y86H

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 400 6.46e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122984
Predicted Effect probably benign
Transcript: ENSMUST00000123650
Predicted Effect probably benign
Transcript: ENSMUST00000126153
AA Change: Y86H

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122079
Gene: ENSMUSG00000025420
AA Change: Y86H

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 425 1.74e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135029
AA Change: Y86H

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115411
Gene: ENSMUSG00000025420
AA Change: Y86H

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 372 2.95e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137354
SMART Domains Protein: ENSMUSP00000118511
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
AAA 25 163 1.74e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137498
AA Change: Y44H

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117495
Gene: ENSMUSG00000025420
AA Change: Y44H

DomainStartEndE-ValueType
AAA 243 381 1.74e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154665
AA Change: Y86H

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119066
Gene: ENSMUSG00000025420
AA Change: Y86H

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,013,331 V1842A probably damaging Het
Abi3 A T 11: 95,842,108 F13L probably benign Het
Adgre4 A G 17: 55,818,758 K538R probably benign Het
Bcas3 C T 11: 85,451,755 H191Y probably benign Het
Bicdl2 A G 17: 23,667,564 T376A probably benign Het
Ceacam18 C A 7: 43,637,073 N123K possibly damaging Het
Celsr3 C T 9: 108,832,025 R1357C possibly damaging Het
Chek2 T C 5: 110,841,282 probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Chrm2 A G 6: 36,523,355 K49R probably damaging Het
Daam1 T A 12: 71,952,459 L623* probably null Het
Ddx31 T A 2: 28,863,770 C448S probably damaging Het
Dnah7a A G 1: 53,547,172 S1507P probably damaging Het
Dnah8 C A 17: 30,746,954 T2420K probably damaging Het
Dyrk3 C T 1: 131,129,695 R247H probably damaging Het
Exoc4 A G 6: 33,265,999 E49G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam96b T C 8: 104,641,650 N14S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxj3 A G 4: 119,619,399 E258G probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Helz2 C T 2: 181,235,528 E1106K probably damaging Het
Hip1 G T 5: 135,436,398 S385R probably benign Het
Igsf9 C T 1: 172,484,511 T8I probably benign Het
Kcnh6 A T 11: 106,027,591 I756F possibly damaging Het
Kdm5b C T 1: 134,607,694 R570* probably null Het
Kif16b T A 2: 142,740,969 R545S probably damaging Het
Kif21b T A 1: 136,172,292 I1528N possibly damaging Het
Kmt2a T C 9: 44,819,274 probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mknk2 T C 10: 80,671,763 T60A probably benign Het
Ncoa6 T C 2: 155,406,987 K1466E probably damaging Het
Ntsr2 A C 12: 16,654,082 T109P probably damaging Het
Nup214 C A 2: 32,017,146 S995Y unknown Het
Olfr448 A T 6: 42,896,520 Q23L probably benign Het
Pclo T A 5: 14,712,736 L456* probably null Het
Pde5a A G 3: 122,748,176 D105G probably damaging Het
Pik3c3 C A 18: 30,323,544 P709H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3c T C 13: 110,061,963 N179S possibly damaging Het
Setdb2 T A 14: 59,409,436 R559S probably benign Het
Sf3b1 A G 1: 55,003,310 Y474H probably benign Het
Slc6a6 G T 6: 91,735,174 W228L probably benign Het
Slc8a2 T G 7: 16,157,303 I750S probably damaging Het
Slco2b1 T A 7: 99,660,044 I194L unknown Het
Smarcd1 C T 15: 99,703,247 Q45* probably null Het
Srcap T G 7: 127,540,320 L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 N9Y probably damaging Het
St7 T C 6: 17,819,318 S74P probably damaging Het
Stxbp5l T A 16: 37,174,326 E739V probably damaging Het
Sun3 T A 11: 9,031,496 Q36L possibly damaging Het
Tbc1d32 T C 10: 56,170,937 H545R possibly damaging Het
Tcp11 A T 17: 28,078,020 C133S probably benign Het
Tm6sf2 T C 8: 70,074,289 V36A possibly damaging Het
Tmem108 T C 9: 103,499,518 Y244C probably damaging Het
Tra2a A T 6: 49,251,015 probably benign Het
Trpm3 A T 19: 22,925,968 I1031F probably damaging Het
Ttll3 A G 6: 113,401,331 K381E probably benign Het
Uaca T C 9: 60,871,148 V937A probably benign Het
Umod C T 7: 119,472,354 G388D probably damaging Het
Vmn2r90 G A 17: 17,704,150 probably null Het
Zfp644 G A 5: 106,635,675 T1002I probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Zfp738 A G 13: 67,671,012 Y287H probably damaging Het
Zfyve16 T C 13: 92,508,263 T1144A probably benign Het
Zgrf1 T C 3: 127,567,703 probably null Het
Other mutations in Katnal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Katnal2 APN 18 77002754 missense probably damaging 1.00
IGL00976:Katnal2 APN 18 77017493 missense probably damaging 1.00
IGL01012:Katnal2 APN 18 77017554 missense probably damaging 0.96
IGL01302:Katnal2 APN 18 77047167 splice site probably benign
IGL01377:Katnal2 APN 18 77002457 missense probably damaging 1.00
IGL01532:Katnal2 APN 18 77012000 missense probably benign
IGL03203:Katnal2 APN 18 77007524 missense probably damaging 1.00
R0592:Katnal2 UTSW 18 77002560 splice site probably null
R1348:Katnal2 UTSW 18 76978542 splice site probably null
R1419:Katnal2 UTSW 18 76977432 missense possibly damaging 0.85
R1755:Katnal2 UTSW 18 77012067 missense probably benign 0.01
R1772:Katnal2 UTSW 18 77002537 missense probably damaging 1.00
R1852:Katnal2 UTSW 18 77016023 missense probably benign 0.08
R1952:Katnal2 UTSW 18 76980011 missense probably benign 0.00
R2115:Katnal2 UTSW 18 76980091 missense probably damaging 1.00
R2155:Katnal2 UTSW 18 77010941 missense probably benign 0.01
R4765:Katnal2 UTSW 18 76977543 intron probably null
R5126:Katnal2 UTSW 18 77017598 missense probably benign 0.13
R5141:Katnal2 UTSW 18 76997641 missense probably damaging 1.00
R5315:Katnal2 UTSW 18 77012009 missense probably benign 0.02
R5412:Katnal2 UTSW 18 77002435 missense probably damaging 1.00
R6289:Katnal2 UTSW 18 77017455 unclassified probably null
R6647:Katnal2 UTSW 18 76980037 missense probably benign 0.01
R6919:Katnal2 UTSW 18 77011038 missense probably benign 0.05
R7039:Katnal2 UTSW 18 77047172 critical splice donor site probably null
R7285:Katnal2 UTSW 18 76993575 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACCATGAGCCTAGGAACACG -3'
(R):5'- GATTTGCAACTCCTGTCTGC -3'

Sequencing Primer
(F):5'- AACACGGGACAGGCTGC -3'
(R):5'- TGCTTTTATTCTTTAAACCCAGACC -3'
Posted On2016-08-04