Mutagenetix > Incidental Mutations

Incidental Mutation 'R5359:Dspp'

424231

Institutional Source

Beutler Lab

Gene Symbol

Dspp

Ensembl Gene

ENSMUSG00000053268

Gene Name

dentin sialophosphoprotein

Synonyms

Dmp3, Dsp, Dpp

MMRRC Submission

042938-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5359 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104170712-104180127 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104175886 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 298 (D298E)

Ref Sequence

ENSEMBL: ENSMUSP00000108391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112771]

Predicted Effect

probably damaging
Transcript: ENSMUST00000112771
AA Change: D298E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: D298E

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
internal_repeat_1	82	245	2.01e-11	PROSPERO
low complexity region	247	268	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
internal_repeat_1	285	438	2.01e-11	PROSPERO
internal_repeat_2	286	369	2.15e-10	PROSPERO
internal_repeat_2	370	454	2.15e-10	PROSPERO
low complexity region	456	472	N/A	INTRINSIC
low complexity region	481	944	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap5b1	T	A	19: 5,569,098	I182N	possibly damaging	Het
Arap2	A	T	5: 62,683,419	C701*	probably null	Het
Bcr	T	A	10: 75,166,085	F940L	probably damaging	Het
Casc1	T	G	6: 145,196,892	T120P	probably damaging	Het
Cav2	A	T	6: 17,287,065		probably benign	Het
Cdk2	T	C	10: 128,703,988		probably benign	Het
Clic4	G	A	4: 135,217,135	A243V	probably benign	Het
Dap3	A	T	3: 88,930,989	V99D	probably damaging	Het
Dennd5a	T	C	7: 109,897,962	E1110G	probably damaging	Het
Dhx30	T	C	9: 110,093,135	N160D	probably damaging	Het
Dock9	A	G	14: 121,653,060	M268T	possibly damaging	Het
Elane	A	G	10: 79,887,036	E92G	probably damaging	Het
Erp44	A	T	4: 48,211,704	D197E	probably benign	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gbf1	T	C	19: 46,283,725		probably null	Het
Gm1968	A	T	16: 29,958,799		noncoding transcript	Het
Hydin	T	A	8: 110,538,372	V2729E	probably benign	Het
Iqgap1	T	C	7: 80,766,959	T106A	probably benign	Het
Kcnj6	G	C	16: 94,832,453	Y248*	probably null	Het
Mllt3	A	G	4: 87,840,927	S295P	probably benign	Het
Olfr1369-ps1	A	C	13: 21,116,267	T192P	probably damaging	Het
Pex11b	G	A	3: 96,643,913	C224Y	probably damaging	Het
Pik3c2g	A	G	6: 139,622,123	Y79C	probably damaging	Het
Plcz1	T	C	6: 140,028,452	Y88C	probably damaging	Het
Pole	A	G	5: 110,332,488	N99S	probably benign	Het
Pyroxd1	T	G	6: 142,361,991	Y496D	probably damaging	Het
Rasef	A	G	4: 73,771,328	L68P	probably damaging	Het
Rgs13	T	A	1: 144,139,584	M132L	probably damaging	Het
RP24-187P11.4	T	G	9: 109,520,876		noncoding transcript	Het
Rsph4a	A	G	10: 33,908,236	T285A	probably benign	Het
Ryr3	A	T	2: 112,775,841		probably null	Het
Slc30a1	T	A	1: 191,909,753	*504R	probably null	Het
Spcs1	T	C	14: 31,000,117	R156G	probably damaging	Het
Supv3l1	A	G	10: 62,432,399	F556L	probably damaging	Het
Thumpd2	C	T	17: 81,026,777	V461M	probably benign	Het
Timm50	A	G	7: 28,308,167	L158P	probably damaging	Het
Tnrc6c	T	C	11: 117,758,905		silent	Het
Ttn	G	A	2: 76,895,803	Q1807*	probably null	Het
Zdhhc14	A	G	17: 5,493,546	I34V	probably benign	Het
Zgrf1	T	A	3: 127,601,165	M506K	possibly damaging	Het

Other mutations in Dspp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Dspp	APN	5	104176892	missense	possibly damaging	0.95
IGL01096:Dspp	APN	5	104175367	missense	possibly damaging	0.92
IGL01317:Dspp	APN	5	104174048	missense	probably damaging	0.99
IGL02365:Dspp	APN	5	104176061	missense	probably damaging	1.00
IGL02387:Dspp	APN	5	104175624	missense	possibly damaging	0.82
IGL02406:Dspp	APN	5	104177366	nonsense	probably null
IGL02445:Dspp	APN	5	104177097	missense	probably damaging	0.99
IGL02481:Dspp	APN	5	104175648	missense	possibly damaging	0.94
IGL02536:Dspp	APN	5	104175665	missense	probably damaging	0.99
IGL02572:Dspp	APN	5	104177069	missense	probably damaging	0.99
IGL02677:Dspp	APN	5	104175977	missense	possibly damaging	0.78
IGL02709:Dspp	APN	5	104177250	missense	unknown
IGL02723:Dspp	APN	5	104175175	missense	probably benign	0.03
IGL02740:Dspp	APN	5	104177238	nonsense	probably null
IGL03274:Dspp	APN	5	104174948	missense	probably damaging	0.99
IGL03293:Dspp	APN	5	104177561	missense	unknown
FR4449:Dspp	UTSW	5	104178388	small deletion	probably benign
R0018:Dspp	UTSW	5	104178230	missense	unknown
R0125:Dspp	UTSW	5	104178039	missense	unknown
R0503:Dspp	UTSW	5	104177256	missense	unknown
R1709:Dspp	UTSW	5	104175724	missense	probably damaging	0.98
R1851:Dspp	UTSW	5	104174085	critical splice donor site	probably null
R2001:Dspp	UTSW	5	104178559	missense	unknown
R2002:Dspp	UTSW	5	104178559	missense	unknown
R2198:Dspp	UTSW	5	104175701	missense	probably benign	0.37
R2279:Dspp	UTSW	5	104178384	missense	unknown
R4026:Dspp	UTSW	5	104177697	missense	unknown
R4066:Dspp	UTSW	5	104177194	missense	unknown
R4632:Dspp	UTSW	5	104177406	missense	unknown
R4693:Dspp	UTSW	5	104178062	missense	unknown
R4841:Dspp	UTSW	5	104177186	missense	unknown
R4841:Dspp	UTSW	5	104177187	missense	unknown
R4917:Dspp	UTSW	5	104177923	missense	unknown
R5008:Dspp	UTSW	5	104175573	missense	possibly damaging	0.66
R5015:Dspp	UTSW	5	104177060	missense	possibly damaging	0.46
R5214:Dspp	UTSW	5	104178498	missense	unknown
R5538:Dspp	UTSW	5	104175230	nonsense	probably null
R5703:Dspp	UTSW	5	104177051	missense	possibly damaging	0.82
R5887:Dspp	UTSW	5	104175455	missense	probably damaging	1.00
R5902:Dspp	UTSW	5	104178111	missense	unknown
R5992:Dspp	UTSW	5	104178451	missense	unknown
R6019:Dspp	UTSW	5	104178039	missense	unknown
R6191:Dspp	UTSW	5	104177348	missense	unknown
R6362:Dspp	UTSW	5	104176034	missense	probably benign	0.19
R6736:Dspp	UTSW	5	104178175	missense	unknown
R6805:Dspp	UTSW	5	104175850	missense	probably benign	0.03
R7064:Dspp	UTSW	5	104176938	missense	possibly damaging	0.73
R7178:Dspp	UTSW	5	104174066	missense	probably benign	0.02
R7243:Dspp	UTSW	5	104178361	small deletion	probably benign
R7390:Dspp	UTSW	5	104175686	missense	probably damaging	0.98
R7454:Dspp	UTSW	5	104175610	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGAGGTGACACCAAGCATC -3'
(R):5'- AAGGACATGCTTCTGACTGG -3'

Sequencing Primer
(F):5'- ATGATACTGATGGGAGTCCTAGC -3'
(R):5'- TGACTGGCTGATGATCCCAC -3'

Posted On

2016-08-04