Mutagenetix > Incidental Mutations

Incidental Mutation 'R5359:Pik3c2g'

424235

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

042938-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R5359 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139622123 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 79 (Y79C)

Ref Sequence

ENSEMBL: ENSMUSP00000141141 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000188066] [ENSMUST00000190962]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032353
AA Change: Y79C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: Y79C

Domain	Start	End	E-Value	Type
SCOP:d1e8xa3	223	344	4e-33	SMART
Blast:PI3K_rbd	272	345	7e-44	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185968
AA Change: Y79C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: Y79C

Domain	Start	End	E-Value	Type
SCOP:d1e8xa3	223	371	2e-42	SMART
Blast:PI3K_rbd	272	371	2e-64	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186585

Predicted Effect

probably damaging
Transcript: ENSMUST00000187618
AA Change: Y79C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: Y79C

Domain	Start	End	E-Value	Type
SCOP:d1e8xa3	223	344	4e-33	SMART
Blast:PI3K_rbd	272	345	7e-44	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000188066
AA Change: Y79C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000190962
AA Change: Y79C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: Y79C

Domain	Start	End	E-Value	Type
SCOP:d1e8xa3	223	344	4e-33	SMART
Blast:PI3K_rbd	272	345	7e-44	BLAST

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap5b1	T	A	19: 5,569,098	I182N	possibly damaging	Het
Arap2	A	T	5: 62,683,419	C701*	probably null	Het
Bcr	T	A	10: 75,166,085	F940L	probably damaging	Het
Casc1	T	G	6: 145,196,892	T120P	probably damaging	Het
Cav2	A	T	6: 17,287,065		probably benign	Het
Cdk2	T	C	10: 128,703,988		probably benign	Het
Clic4	G	A	4: 135,217,135	A243V	probably benign	Het
Dap3	A	T	3: 88,930,989	V99D	probably damaging	Het
Dennd5a	T	C	7: 109,897,962	E1110G	probably damaging	Het
Dhx30	T	C	9: 110,093,135	N160D	probably damaging	Het
Dock9	A	G	14: 121,653,060	M268T	possibly damaging	Het
Dspp	T	A	5: 104,175,886	D298E	probably damaging	Het
Elane	A	G	10: 79,887,036	E92G	probably damaging	Het
Erp44	A	T	4: 48,211,704	D197E	probably benign	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gbf1	T	C	19: 46,283,725		probably null	Het
Gm1968	A	T	16: 29,958,799		noncoding transcript	Het
Hydin	T	A	8: 110,538,372	V2729E	probably benign	Het
Iqgap1	T	C	7: 80,766,959	T106A	probably benign	Het
Kcnj6	G	C	16: 94,832,453	Y248*	probably null	Het
Mllt3	A	G	4: 87,840,927	S295P	probably benign	Het
Olfr1369-ps1	A	C	13: 21,116,267	T192P	probably damaging	Het
Pex11b	G	A	3: 96,643,913	C224Y	probably damaging	Het
Plcz1	T	C	6: 140,028,452	Y88C	probably damaging	Het
Pole	A	G	5: 110,332,488	N99S	probably benign	Het
Pyroxd1	T	G	6: 142,361,991	Y496D	probably damaging	Het
Rasef	A	G	4: 73,771,328	L68P	probably damaging	Het
Rgs13	T	A	1: 144,139,584	M132L	probably damaging	Het
RP24-187P11.4	T	G	9: 109,520,876		noncoding transcript	Het
Rsph4a	A	G	10: 33,908,236	T285A	probably benign	Het
Ryr3	A	T	2: 112,775,841		probably null	Het
Slc30a1	T	A	1: 191,909,753	*504R	probably null	Het
Spcs1	T	C	14: 31,000,117	R156G	probably damaging	Het
Supv3l1	A	G	10: 62,432,399	F556L	probably damaging	Het
Thumpd2	C	T	17: 81,026,777	V461M	probably benign	Het
Timm50	A	G	7: 28,308,167	L158P	probably damaging	Het
Tnrc6c	T	C	11: 117,758,905		silent	Het
Ttn	G	A	2: 76,895,803	Q1807*	probably null	Het
Zdhhc14	A	G	17: 5,493,546	I34V	probably benign	Het
Zgrf1	T	A	3: 127,601,165	M506K	possibly damaging	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
R8888:Pik3c2g	UTSW	6	139730366	nonsense	probably null
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATACAGTTGGCAAACAGAGC -3'
(R):5'- TGCCATGATATTTTCCACTGGG -3'

Sequencing Primer
(F):5'- CACAGGAAGATGGATCTGATACCC -3'
(R):5'- TCCACTGGGATTTCTCCAGGAAG -3'

Posted On

2016-08-04