Incidental Mutation 'R5359:Pyroxd1'
ID424237
Institutional Source Beutler Lab
Gene Symbol Pyroxd1
Ensembl Gene ENSMUSG00000041671
Gene Namepyridine nucleotide-disulphide oxidoreductase domain 1
Synonyms
MMRRC Submission 042938-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5359 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142345654-142363257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 142361991 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 496 (Y496D)
Ref Sequence ENSEMBL: ENSMUSP00000036394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832] [ENSMUST00000111803]
Predicted Effect probably benign
Transcript: ENSMUST00000032370
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041852
AA Change: Y496D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: Y496D

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 8 234 2.2e-18 PFAM
Pfam:Pyr_redox_2 266 381 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100832
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111803
SMART Domains Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RecQ_Zn_bind 420 479 2.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123289
Predicted Effect probably benign
Transcript: ENSMUST00000123912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138578
Predicted Effect probably benign
Transcript: ENSMUST00000141504
SMART Domains Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
Pfam:RecQ_Zn_bind 10 69 7.1e-16 PFAM
Pfam:RQC 73 187 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155149
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5b1 T A 19: 5,569,098 I182N possibly damaging Het
Arap2 A T 5: 62,683,419 C701* probably null Het
Bcr T A 10: 75,166,085 F940L probably damaging Het
Casc1 T G 6: 145,196,892 T120P probably damaging Het
Cav2 A T 6: 17,287,065 probably benign Het
Cdk2 T C 10: 128,703,988 probably benign Het
Clic4 G A 4: 135,217,135 A243V probably benign Het
Dap3 A T 3: 88,930,989 V99D probably damaging Het
Dennd5a T C 7: 109,897,962 E1110G probably damaging Het
Dhx30 T C 9: 110,093,135 N160D probably damaging Het
Dock9 A G 14: 121,653,060 M268T possibly damaging Het
Dspp T A 5: 104,175,886 D298E probably damaging Het
Elane A G 10: 79,887,036 E92G probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gbf1 T C 19: 46,283,725 probably null Het
Gm1968 A T 16: 29,958,799 noncoding transcript Het
Hydin T A 8: 110,538,372 V2729E probably benign Het
Iqgap1 T C 7: 80,766,959 T106A probably benign Het
Kcnj6 G C 16: 94,832,453 Y248* probably null Het
Mllt3 A G 4: 87,840,927 S295P probably benign Het
Olfr1369-ps1 A C 13: 21,116,267 T192P probably damaging Het
Pex11b G A 3: 96,643,913 C224Y probably damaging Het
Pik3c2g A G 6: 139,622,123 Y79C probably damaging Het
Plcz1 T C 6: 140,028,452 Y88C probably damaging Het
Pole A G 5: 110,332,488 N99S probably benign Het
Rasef A G 4: 73,771,328 L68P probably damaging Het
Rgs13 T A 1: 144,139,584 M132L probably damaging Het
RP24-187P11.4 T G 9: 109,520,876 noncoding transcript Het
Rsph4a A G 10: 33,908,236 T285A probably benign Het
Ryr3 A T 2: 112,775,841 probably null Het
Slc30a1 T A 1: 191,909,753 *504R probably null Het
Spcs1 T C 14: 31,000,117 R156G probably damaging Het
Supv3l1 A G 10: 62,432,399 F556L probably damaging Het
Thumpd2 C T 17: 81,026,777 V461M probably benign Het
Timm50 A G 7: 28,308,167 L158P probably damaging Het
Tnrc6c T C 11: 117,758,905 silent Het
Ttn G A 2: 76,895,803 Q1807* probably null Het
Zdhhc14 A G 17: 5,493,546 I34V probably benign Het
Zgrf1 T A 3: 127,601,165 M506K possibly damaging Het
Other mutations in Pyroxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Pyroxd1 APN 6 142361758 missense probably damaging 0.96
IGL01720:Pyroxd1 APN 6 142351058 splice site probably benign
IGL02139:Pyroxd1 APN 6 142354731 missense probably benign
IGL02930:Pyroxd1 APN 6 142359052 missense probably damaging 1.00
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0329:Pyroxd1 UTSW 6 142361976 missense probably benign 0.37
R0505:Pyroxd1 UTSW 6 142353562 missense possibly damaging 0.55
R0552:Pyroxd1 UTSW 6 142345737 missense probably benign 0.06
R1073:Pyroxd1 UTSW 6 142348644 critical splice donor site probably null
R1319:Pyroxd1 UTSW 6 142359148 missense probably benign 0.33
R2200:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R4638:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4639:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4640:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4641:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4642:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4643:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4645:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4687:Pyroxd1 UTSW 6 142361868 missense probably benign 0.00
R5688:Pyroxd1 UTSW 6 142353540 missense probably damaging 1.00
R6208:Pyroxd1 UTSW 6 142357456 missense probably benign 0.00
R6295:Pyroxd1 UTSW 6 142354753 missense probably benign 0.00
R7056:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R7445:Pyroxd1 UTSW 6 142358501 missense probably benign 0.03
R8925:Pyroxd1 UTSW 6 142354711 missense probably damaging 1.00
R8927:Pyroxd1 UTSW 6 142354711 missense probably damaging 1.00
V1662:Pyroxd1 UTSW 6 142358443 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCATGAGTTGATGCTGAGG -3'
(R):5'- TAGAGGAGGAGTGTTCATCTGC -3'

Sequencing Primer
(F):5'- TGATGCTGAGGTGCACCAG -3'
(R):5'- AGGAGTGTTCATCTGCAAATGAGTC -3'
Posted On2016-08-04