Incidental Mutation 'R5359:Casc1'
ID 424238
Institutional Source Beutler Lab
Gene Symbol Casc1
Ensembl Gene ENSMUSG00000043541
Gene Name cancer susceptibility candidate 1
Synonyms A230084G12Rik, Las1
MMRRC Submission 042938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R5359 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 145174834-145211005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 145196892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 120 (T120P)
Ref Sequence ENSEMBL: ENSMUSP00000144783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000060797
AA Change: T120P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: T120P

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably damaging
Transcript: ENSMUST00000111728
AA Change: T107P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: T107P

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152138
Predicted Effect probably damaging
Transcript: ENSMUST00000204105
AA Change: T120P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: T120P

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5b1 T A 19: 5,569,098 I182N possibly damaging Het
Arap2 A T 5: 62,683,419 C701* probably null Het
Bcr T A 10: 75,166,085 F940L probably damaging Het
Cav2 A T 6: 17,287,065 probably benign Het
Cdk2 T C 10: 128,703,988 probably benign Het
Clic4 G A 4: 135,217,135 A243V probably benign Het
Dap3 A T 3: 88,930,989 V99D probably damaging Het
Dennd5a T C 7: 109,897,962 E1110G probably damaging Het
Dhx30 T C 9: 110,093,135 N160D probably damaging Het
Dock9 A G 14: 121,653,060 M268T possibly damaging Het
Dspp T A 5: 104,175,886 D298E probably damaging Het
Elane A G 10: 79,887,036 E92G probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gbf1 T C 19: 46,283,725 probably null Het
Gm1968 A T 16: 29,958,799 noncoding transcript Het
Hydin T A 8: 110,538,372 V2729E probably benign Het
Iqgap1 T C 7: 80,766,959 T106A probably benign Het
Kcnj6 G C 16: 94,832,453 Y248* probably null Het
Mllt3 A G 4: 87,840,927 S295P probably benign Het
Olfr1369-ps1 A C 13: 21,116,267 T192P probably damaging Het
Pex11b G A 3: 96,643,913 C224Y probably damaging Het
Pik3c2g A G 6: 139,622,123 Y79C probably damaging Het
Plcz1 T C 6: 140,028,452 Y88C probably damaging Het
Pole A G 5: 110,332,488 N99S probably benign Het
Pyroxd1 T G 6: 142,361,991 Y496D probably damaging Het
Rasef A G 4: 73,771,328 L68P probably damaging Het
Rgs13 T A 1: 144,139,584 M132L probably damaging Het
RP24-187P11.4 T G 9: 109,520,876 noncoding transcript Het
Rsph4a A G 10: 33,908,236 T285A probably benign Het
Ryr3 A T 2: 112,775,841 probably null Het
Slc30a1 T A 1: 191,909,753 *504R probably null Het
Spcs1 T C 14: 31,000,117 R156G probably damaging Het
Supv3l1 A G 10: 62,432,399 F556L probably damaging Het
Thumpd2 C T 17: 81,026,777 V461M probably benign Het
Timm50 A G 7: 28,308,167 L158P probably damaging Het
Tnrc6c T C 11: 117,758,905 silent Het
Ttn G A 2: 76,895,803 Q1807* probably null Het
Zdhhc14 A G 17: 5,493,546 I34V probably benign Het
Zgrf1 T A 3: 127,601,165 M506K possibly damaging Het
Other mutations in Casc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Casc1 APN 6 145175290 missense probably benign 0.00
IGL00586:Casc1 APN 6 145191576 missense possibly damaging 0.53
IGL01066:Casc1 APN 6 145176222 missense probably damaging 0.96
IGL01413:Casc1 APN 6 145175086 missense probably damaging 1.00
IGL02275:Casc1 APN 6 145177364 missense probably damaging 1.00
IGL02668:Casc1 APN 6 145205257 missense unknown
IGL03018:Casc1 APN 6 145183305 missense probably damaging 1.00
IGL03233:Casc1 APN 6 145181885 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0180:Casc1 UTSW 6 145183218 critical splice donor site probably benign
R0786:Casc1 UTSW 6 145181757 critical splice donor site probably null
R1916:Casc1 UTSW 6 145176200 missense probably benign 0.37
R2117:Casc1 UTSW 6 145205241 critical splice donor site probably null
R2174:Casc1 UTSW 6 145175170 missense probably damaging 1.00
R2264:Casc1 UTSW 6 145208429 utr 5 prime probably benign
R4393:Casc1 UTSW 6 145194578 missense possibly damaging 0.49
R4467:Casc1 UTSW 6 145183218 critical splice donor site probably null
R4847:Casc1 UTSW 6 145175185 missense probably damaging 1.00
R5014:Casc1 UTSW 6 145183266 missense probably damaging 1.00
R5207:Casc1 UTSW 6 145179068 missense probably damaging 1.00
R5264:Casc1 UTSW 6 145181776 missense probably benign 0.02
R5499:Casc1 UTSW 6 145177431 missense probably damaging 1.00
R6211:Casc1 UTSW 6 145200491 missense probably damaging 1.00
R6579:Casc1 UTSW 6 145179018 missense probably benign 0.19
R6939:Casc1 UTSW 6 145175219 missense possibly damaging 0.46
R7108:Casc1 UTSW 6 145185865 nonsense probably null
R7131:Casc1 UTSW 6 145177406 missense probably null 0.97
R7810:Casc1 UTSW 6 145194586 missense probably benign 0.28
R8017:Casc1 UTSW 6 145194557 missense probably damaging 1.00
R8385:Casc1 UTSW 6 145175192 missense probably damaging 1.00
R8680:Casc1 UTSW 6 145181816 missense probably benign 0.13
R8720:Casc1 UTSW 6 145205257 missense unknown
R9118:Casc1 UTSW 6 145175174 missense probably damaging 1.00
R9118:Casc1 UTSW 6 145175245 missense probably damaging 1.00
R9172:Casc1 UTSW 6 145177449 missense probably benign
R9290:Casc1 UTSW 6 145202962 missense unknown
X0063:Casc1 UTSW 6 145175271 missense probably benign 0.13
Z1176:Casc1 UTSW 6 145205293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGTAAGGTGGGGAAGCACA -3'
(R):5'- GGTACTTATGTTGAGGCTTCAGATT -3'

Sequencing Primer
(F):5'- AGGCAGGCAGGGCTCAG -3'
(R):5'- CAATGGATAAATGTGCTTGCCGC -3'
Posted On 2016-08-04