Incidental Mutation 'R5359:Dock9'
ID424253
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Namededicator of cytokinesis 9
SynonymsD14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission 042938-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5359 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location121542046-121797837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121653060 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 268 (M268T)
Ref Sequence ENSEMBL: ENSMUSP00000097872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: M266T

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: M266T

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100299
AA Change: M268T

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: M268T

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: M266T

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000212376
AA Change: M280T

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5b1 T A 19: 5,569,098 I182N possibly damaging Het
Arap2 A T 5: 62,683,419 C701* probably null Het
Bcr T A 10: 75,166,085 F940L probably damaging Het
Casc1 T G 6: 145,196,892 T120P probably damaging Het
Cav2 A T 6: 17,287,065 probably benign Het
Cdk2 T C 10: 128,703,988 probably benign Het
Clic4 G A 4: 135,217,135 A243V probably benign Het
Dap3 A T 3: 88,930,989 V99D probably damaging Het
Dennd5a T C 7: 109,897,962 E1110G probably damaging Het
Dhx30 T C 9: 110,093,135 N160D probably damaging Het
Dspp T A 5: 104,175,886 D298E probably damaging Het
Elane A G 10: 79,887,036 E92G probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gbf1 T C 19: 46,283,725 probably null Het
Gm1968 A T 16: 29,958,799 noncoding transcript Het
Hydin T A 8: 110,538,372 V2729E probably benign Het
Iqgap1 T C 7: 80,766,959 T106A probably benign Het
Kcnj6 G C 16: 94,832,453 Y248* probably null Het
Mllt3 A G 4: 87,840,927 S295P probably benign Het
Olfr1369-ps1 A C 13: 21,116,267 T192P probably damaging Het
Pex11b G A 3: 96,643,913 C224Y probably damaging Het
Pik3c2g A G 6: 139,622,123 Y79C probably damaging Het
Plcz1 T C 6: 140,028,452 Y88C probably damaging Het
Pole A G 5: 110,332,488 N99S probably benign Het
Pyroxd1 T G 6: 142,361,991 Y496D probably damaging Het
Rasef A G 4: 73,771,328 L68P probably damaging Het
Rgs13 T A 1: 144,139,584 M132L probably damaging Het
RP24-187P11.4 T G 9: 109,520,876 noncoding transcript Het
Rsph4a A G 10: 33,908,236 T285A probably benign Het
Ryr3 A T 2: 112,775,841 probably null Het
Slc30a1 T A 1: 191,909,753 *504R probably null Het
Spcs1 T C 14: 31,000,117 R156G probably damaging Het
Supv3l1 A G 10: 62,432,399 F556L probably damaging Het
Thumpd2 C T 17: 81,026,777 V461M probably benign Het
Timm50 A G 7: 28,308,167 L158P probably damaging Het
Tnrc6c T C 11: 117,758,905 silent Het
Ttn G A 2: 76,895,803 Q1807* probably null Het
Zdhhc14 A G 17: 5,493,546 I34V probably benign Het
Zgrf1 T A 3: 127,601,165 M506K possibly damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGACAAACTGTGAAAGGC -3'
(R):5'- TTTTAATGGGGCATCGGAGAGC -3'

Sequencing Primer
(F):5'- TGAAAGGCTCACATCTTCCTAC -3'
(R):5'- TCGGAGAGCCAATAAGAAAGCACC -3'
Posted On2016-08-04