Incidental Mutation 'R5359:Thumpd2'
ID424258
Institutional Source Beutler Lab
Gene Symbol Thumpd2
Ensembl Gene ENSMUSG00000024246
Gene NameTHUMP domain containing 2
Synonyms
MMRRC Submission 042938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5359 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location81026327-81065085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81026777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 461 (V461M)
Ref Sequence ENSEMBL: ENSMUSP00000025093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025093]
Predicted Effect probably benign
Transcript: ENSMUST00000025093
AA Change: V461M

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025093
Gene: ENSMUSG00000024246
AA Change: V461M

DomainStartEndE-ValueType
THUMP 175 266 4.08e-2 SMART
Pfam:UPF0020 272 425 3e-27 PFAM
Pfam:CMAS 284 429 3e-7 PFAM
Pfam:Ubie_methyltran 285 417 3e-10 PFAM
Pfam:MTS 289 417 2.1e-7 PFAM
Pfam:Methyltransf_31 296 441 7.8e-14 PFAM
Pfam:Methyltransf_11 303 406 1.9e-10 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5b1 T A 19: 5,569,098 I182N possibly damaging Het
Arap2 A T 5: 62,683,419 C701* probably null Het
Bcr T A 10: 75,166,085 F940L probably damaging Het
Casc1 T G 6: 145,196,892 T120P probably damaging Het
Cav2 A T 6: 17,287,065 probably benign Het
Cdk2 T C 10: 128,703,988 probably benign Het
Clic4 G A 4: 135,217,135 A243V probably benign Het
Dap3 A T 3: 88,930,989 V99D probably damaging Het
Dennd5a T C 7: 109,897,962 E1110G probably damaging Het
Dhx30 T C 9: 110,093,135 N160D probably damaging Het
Dock9 A G 14: 121,653,060 M268T possibly damaging Het
Dspp T A 5: 104,175,886 D298E probably damaging Het
Elane A G 10: 79,887,036 E92G probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gbf1 T C 19: 46,283,725 probably null Het
Gm1968 A T 16: 29,958,799 noncoding transcript Het
Hydin T A 8: 110,538,372 V2729E probably benign Het
Iqgap1 T C 7: 80,766,959 T106A probably benign Het
Kcnj6 G C 16: 94,832,453 Y248* probably null Het
Mllt3 A G 4: 87,840,927 S295P probably benign Het
Olfr1369-ps1 A C 13: 21,116,267 T192P probably damaging Het
Pex11b G A 3: 96,643,913 C224Y probably damaging Het
Pik3c2g A G 6: 139,622,123 Y79C probably damaging Het
Plcz1 T C 6: 140,028,452 Y88C probably damaging Het
Pole A G 5: 110,332,488 N99S probably benign Het
Pyroxd1 T G 6: 142,361,991 Y496D probably damaging Het
Rasef A G 4: 73,771,328 L68P probably damaging Het
Rgs13 T A 1: 144,139,584 M132L probably damaging Het
RP24-187P11.4 T G 9: 109,520,876 noncoding transcript Het
Rsph4a A G 10: 33,908,236 T285A probably benign Het
Ryr3 A T 2: 112,775,841 probably null Het
Slc30a1 T A 1: 191,909,753 *504R probably null Het
Spcs1 T C 14: 31,000,117 R156G probably damaging Het
Supv3l1 A G 10: 62,432,399 F556L probably damaging Het
Timm50 A G 7: 28,308,167 L158P probably damaging Het
Tnrc6c T C 11: 117,758,905 silent Het
Ttn G A 2: 76,895,803 Q1807* probably null Het
Zdhhc14 A G 17: 5,493,546 I34V probably benign Het
Zgrf1 T A 3: 127,601,165 M506K possibly damaging Het
Other mutations in Thumpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01750:Thumpd2 APN 17 81054386 missense probably benign 0.00
IGL02409:Thumpd2 APN 17 81032688 missense probably damaging 1.00
IGL02546:Thumpd2 APN 17 81054455 missense probably benign 0.16
IGL03357:Thumpd2 APN 17 81044090 splice site probably benign
R1295:Thumpd2 UTSW 17 81055888 missense probably damaging 1.00
R2030:Thumpd2 UTSW 17 81064958 missense probably damaging 1.00
R2898:Thumpd2 UTSW 17 81044128 nonsense probably null
R4805:Thumpd2 UTSW 17 81026701 missense probably damaging 0.98
R4861:Thumpd2 UTSW 17 81026801 missense probably benign 0.03
R4861:Thumpd2 UTSW 17 81026801 missense probably benign 0.03
R5328:Thumpd2 UTSW 17 81044162 missense possibly damaging 0.64
R6207:Thumpd2 UTSW 17 81055837 missense probably damaging 1.00
R6218:Thumpd2 UTSW 17 81052913 missense probably damaging 1.00
R6484:Thumpd2 UTSW 17 81054188 missense probably benign 0.01
R6853:Thumpd2 UTSW 17 81065030 missense possibly damaging 0.75
R6855:Thumpd2 UTSW 17 81044170 missense probably damaging 1.00
R6917:Thumpd2 UTSW 17 81044114 missense probably benign 0.00
R7018:Thumpd2 UTSW 17 81055897 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATACAGGCTGTGTTCTTGGAGC -3'
(R):5'- GCCATGGTCTTGTTGCTCAG -3'

Sequencing Primer
(F):5'- TCCGGGGCTATAAGGAATCCTG -3'
(R):5'- GTGAAGATCACCACCGGC -3'
Posted On2016-08-04