Incidental Mutation 'R5359:Ap5b1'
ID424259
Institutional Source Beutler Lab
Gene Symbol Ap5b1
Ensembl Gene ENSMUSG00000049562
Gene Nameadaptor-related protein complex 5, beta 1 subunit
SynonymsGm962
MMRRC Submission 042938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5359 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5568074-5571261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5569098 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 182 (I182N)
Ref Sequence ENSEMBL: ENSMUSP00000094042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096318
AA Change: I182N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094042
Gene: ENSMUSG00000049562
AA Change: I182N

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 68 75 N/A INTRINSIC
low complexity region 84 104 N/A INTRINSIC
low complexity region 114 136 N/A INTRINSIC
low complexity region 185 199 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
low complexity region 511 524 N/A INTRINSIC
low complexity region 616 644 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,683,419 C701* probably null Het
Bcr T A 10: 75,166,085 F940L probably damaging Het
Casc1 T G 6: 145,196,892 T120P probably damaging Het
Cav2 A T 6: 17,287,065 probably benign Het
Cdk2 T C 10: 128,703,988 probably benign Het
Clic4 G A 4: 135,217,135 A243V probably benign Het
Dap3 A T 3: 88,930,989 V99D probably damaging Het
Dennd5a T C 7: 109,897,962 E1110G probably damaging Het
Dhx30 T C 9: 110,093,135 N160D probably damaging Het
Dock9 A G 14: 121,653,060 M268T possibly damaging Het
Dspp T A 5: 104,175,886 D298E probably damaging Het
Elane A G 10: 79,887,036 E92G probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gbf1 T C 19: 46,283,725 probably null Het
Gm1968 A T 16: 29,958,799 noncoding transcript Het
Hydin T A 8: 110,538,372 V2729E probably benign Het
Iqgap1 T C 7: 80,766,959 T106A probably benign Het
Kcnj6 G C 16: 94,832,453 Y248* probably null Het
Mllt3 A G 4: 87,840,927 S295P probably benign Het
Olfr1369-ps1 A C 13: 21,116,267 T192P probably damaging Het
Pex11b G A 3: 96,643,913 C224Y probably damaging Het
Pik3c2g A G 6: 139,622,123 Y79C probably damaging Het
Plcz1 T C 6: 140,028,452 Y88C probably damaging Het
Pole A G 5: 110,332,488 N99S probably benign Het
Pyroxd1 T G 6: 142,361,991 Y496D probably damaging Het
Rasef A G 4: 73,771,328 L68P probably damaging Het
Rgs13 T A 1: 144,139,584 M132L probably damaging Het
RP24-187P11.4 T G 9: 109,520,876 noncoding transcript Het
Rsph4a A G 10: 33,908,236 T285A probably benign Het
Ryr3 A T 2: 112,775,841 probably null Het
Slc30a1 T A 1: 191,909,753 *504R probably null Het
Spcs1 T C 14: 31,000,117 R156G probably damaging Het
Supv3l1 A G 10: 62,432,399 F556L probably damaging Het
Thumpd2 C T 17: 81,026,777 V461M probably benign Het
Timm50 A G 7: 28,308,167 L158P probably damaging Het
Tnrc6c T C 11: 117,758,905 silent Het
Ttn G A 2: 76,895,803 Q1807* probably null Het
Zdhhc14 A G 17: 5,493,546 I34V probably benign Het
Zgrf1 T A 3: 127,601,165 M506K possibly damaging Het
Other mutations in Ap5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Ap5b1 APN 19 5570979 nonsense probably null
IGL02121:Ap5b1 APN 19 5570787 missense possibly damaging 0.92
R1513:Ap5b1 UTSW 19 5569864 nonsense probably null
R2004:Ap5b1 UTSW 19 5570474 missense possibly damaging 0.83
R2036:Ap5b1 UTSW 19 5568869 missense possibly damaging 0.83
R2282:Ap5b1 UTSW 19 5569637 missense possibly damaging 0.66
R3441:Ap5b1 UTSW 19 5569983 missense probably benign
R3835:Ap5b1 UTSW 19 5568890 missense possibly damaging 0.66
R4241:Ap5b1 UTSW 19 5568797 missense possibly damaging 0.92
R5324:Ap5b1 UTSW 19 5569835 missense possibly damaging 0.66
R7102:Ap5b1 UTSW 19 5570187 missense possibly damaging 0.92
R7132:Ap5b1 UTSW 19 5569384 nonsense probably null
R8548:Ap5b1 UTSW 19 5571095 missense possibly damaging 0.46
Z1088:Ap5b1 UTSW 19 5570424 missense possibly damaging 0.82
Z1177:Ap5b1 UTSW 19 5570928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTCTTGGCTTAGCTTCAGG -3'
(R):5'- TCTAGAACCGGAAAGCCACG -3'

Sequencing Primer
(F):5'- CTTAGCTTCAGGCCGAGACTTG -3'
(R):5'- GGAAAGCCACGCTCCTC -3'
Posted On2016-08-04