Mutagenetix > Incidental Mutations

Incidental Mutation 'R5360:Aox3'

424261

Institutional Source

Beutler Lab

Gene Symbol

Aox3

Ensembl Gene

ENSMUSG00000064294

Gene Name

aldehyde oxidase 3

Synonyms

AOH1, 1200011D03Rik

MMRRC Submission

042939-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5360 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58113130-58200698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58146508 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 331 (T331M)

Ref Sequence

ENSEMBL: ENSMUSP00000049391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040999]

PDB Structure

Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040999
AA Change: T331M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: T331M

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.4e-9	PFAM
Pfam:Fer2_2	91	165	1e-29	PFAM
Pfam:FAD_binding_5	239	419	1e-44	PFAM
CO_deh_flav_C	426	530	9.26e-24	SMART
Ald_Xan_dh_C	594	697	2.27e-41	SMART
Pfam:Ald_Xan_dh_C2	708	1241	8.7e-183	PFAM
low complexity region	1275	1286	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Acsl5	T	A	19: 55,291,160	Y443*	probably null	Het
Arhgap32	G	A	9: 32,259,671	R1598H	probably damaging	Het
Atp1a2	A	G	1: 172,278,869		probably null	Het
Brpf3	A	T	17: 28,810,562	M499L	probably benign	Het
Cacnb1	A	T	11: 98,018,271		probably null	Het
Cep295	A	G	9: 15,326,733	S1899P	probably damaging	Het
Cntn2	A	G	1: 132,518,857	Y748H	probably damaging	Het
Csmd3	T	A	15: 47,669,203	Y2532F	probably damaging	Het
D17Wsu92e	A	T	17: 27,794,046	I59N	probably damaging	Het
Dsg1a	A	G	18: 20,340,954	D1028G	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabra5	C	T	7: 57,490,785	G55R	probably damaging	Het
Gdf9	T	A	11: 53,437,207	F330Y	probably benign	Het
Gimap8	T	C	6: 48,656,302	S352P	probably damaging	Het
Gm4952	A	T	19: 12,623,629	H71L	probably benign	Het
Gm6803	A	C	12: 88,018,495	L93V	probably benign	Het
Gnaq	G	A	19: 16,133,426	R34H	probably benign	Het
Hebp2	T	C	10: 18,544,307	D126G	probably benign	Het
Hectd4	A	G	5: 121,315,401	D601G	possibly damaging	Het
Hook2	T	C	8: 85,001,404	Y577H	probably damaging	Het
Igfals	A	G	17: 24,880,093	T53A	probably benign	Het
Igsf9b	A	G	9: 27,311,672	D123G	probably damaging	Het
Ikbkap	A	T	4: 56,800,104	H7Q	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mdm4	A	T	1: 132,991,658	*490K	probably null	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Neurl2	C	A	2: 164,833,101	A114S	probably damaging	Het
Nuggc	A	G	14: 65,638,626	T563A	probably damaging	Het
Olfr951	T	G	9: 39,394,402	F204V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pdlim1	A	T	19: 40,230,549	S213T	probably damaging	Het
Pitx1	T	C	13: 55,828,478	I123V	probably damaging	Het
Pkd1l1	T	C	11: 8,879,204	N1013D	probably benign	Het
Pla2g2c	T	A	4: 138,734,345	Y42N	possibly damaging	Het
Polr2b	G	A	5: 77,349,146	A1168T	possibly damaging	Het
Ppp2r2a	G	A	14: 67,016,571	R383*	probably null	Het
Prl7a2	C	T	13: 27,659,160	R220H	probably benign	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rc3h2	A	G	2: 37,389,855	V454A	possibly damaging	Het
Robo1	A	G	16: 72,935,777	T307A	probably damaging	Het
Slc22a6	T	C	19: 8,619,422	L188P	probably damaging	Het
Spag17	A	G	3: 100,109,410	N2167S	probably benign	Het
Spag5	G	A	11: 78,314,762	E680K	probably damaging	Het
Spata6	A	G	4: 111,822,829	Y428C	possibly damaging	Het
Tbc1d5	T	C	17: 50,984,632	D47G	probably benign	Het
Trp53	T	C	11: 69,588,740		probably null	Het
Tsc22d1	TCAGCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCA	14: 76,417,267		probably benign	Het
Ttc39b	T	C	4: 83,261,847	D103G	probably damaging	Het
Ttn	A	C	2: 76,919,978	W3576G	probably benign	Het
Yeats2	T	A	16: 20,154,162	M22K	probably damaging	Het

Other mutations in Aox3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Aox3	APN	1	58169794	missense	probably damaging	1.00
IGL01747:Aox3	APN	1	58159658	missense	probably damaging	0.97
IGL01883:Aox3	APN	1	58138283	missense	probably damaging	1.00
IGL01911:Aox3	APN	1	58152560	missense	probably benign	0.04
IGL02017:Aox3	APN	1	58120992	missense	probably damaging	1.00
IGL02120:Aox3	APN	1	58127650	missense	probably benign	0.00
IGL02466:Aox3	APN	1	58158272	missense	probably benign	0.28
IGL02545:Aox3	APN	1	58183486	missense	probably damaging	1.00
IGL02572:Aox3	APN	1	58158367	missense	probably damaging	1.00
IGL02746:Aox3	APN	1	58183542	missense	possibly damaging	0.83
IGL02808:Aox3	APN	1	58142700	missense	probably damaging	0.99
IGL02812:Aox3	APN	1	58165896	missense	probably benign	0.00
IGL02982:Aox3	APN	1	58127687	missense	probably benign	0.00
IGL03056:Aox3	APN	1	58159021	critical splice donor site	probably null
IGL03182:Aox3	APN	1	58165887	missense	probably benign	0.02
IGL03234:Aox3	APN	1	58152686	missense	probably benign
IGL03374:Aox3	APN	1	58171848	missense	probably damaging	1.00
amber	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0135:Aox3	UTSW	1	58125088	splice site	probably benign
R0332:Aox3	UTSW	1	58142751	missense	probably benign	0.00
R0626:Aox3	UTSW	1	58172299	missense	possibly damaging	0.94
R1325:Aox3	UTSW	1	58176567	nonsense	probably null
R1435:Aox3	UTSW	1	58163446	critical splice donor site	probably null
R1438:Aox3	UTSW	1	58153178	missense	probably benign
R1567:Aox3	UTSW	1	58194693	missense	probably damaging	0.96
R1575:Aox3	UTSW	1	58152554	missense	probably benign	0.04
R1759:Aox3	UTSW	1	58170646	splice site	probably null
R1785:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1786:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1921:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R1984:Aox3	UTSW	1	58153061	missense	possibly damaging	0.88
R2012:Aox3	UTSW	1	58138232	missense	probably benign	0.02
R2080:Aox3	UTSW	1	58186280	missense	probably benign	0.06
R2121:Aox3	UTSW	1	58152549	splice site	probably benign
R2126:Aox3	UTSW	1	58158216	missense	probably benign	0.25
R2130:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2131:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2132:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2133:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2385:Aox3	UTSW	1	58138289	missense	probably damaging	1.00
R2495:Aox3	UTSW	1	58188408	missense	probably damaging	0.99
R4200:Aox3	UTSW	1	58188378	missense	probably damaging	1.00
R4231:Aox3	UTSW	1	58114885	missense	probably benign	0.12
R4591:Aox3	UTSW	1	58152656	missense	probably damaging	0.99
R4627:Aox3	UTSW	1	58125035	missense	probably damaging	0.98
R4831:Aox3	UTSW	1	58152566	missense	probably damaging	0.97
R4864:Aox3	UTSW	1	58176487	missense	probably damaging	1.00
R4976:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5007:Aox3	UTSW	1	58163424	missense	probably benign
R5119:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5175:Aox3	UTSW	1	58172328	missense	probably benign	0.01
R5784:Aox3	UTSW	1	58153499	missense	probably benign	0.00
R6050:Aox3	UTSW	1	58180655	missense	possibly damaging	0.93
R6056:Aox3	UTSW	1	58169859	missense	probably damaging	1.00
R6162:Aox3	UTSW	1	58159731	missense	possibly damaging	0.75
R6181:Aox3	UTSW	1	58158946	missense	probably benign	0.03
R6374:Aox3	UTSW	1	58172161	missense	probably benign	0.11
R6662:Aox3	UTSW	1	58118615	missense	probably damaging	1.00
R6809:Aox3	UTSW	1	58118681	missense	probably damaging	0.99
R6810:Aox3	UTSW	1	58141431	missense	probably benign	0.00
R6821:Aox3	UTSW	1	58150388	missense	probably benign	0.04
R7039:Aox3	UTSW	1	58176555	missense	probably damaging	1.00
R7116:Aox3	UTSW	1	58153530	missense	probably benign	0.01
R7146:Aox3	UTSW	1	58158529	intron	probably null
R7163:Aox3	UTSW	1	58119512	missense	probably damaging	0.99
R7243:Aox3	UTSW	1	58138307	missense	unknown
R7319:Aox3	UTSW	1	58152602	missense	probably benign	0.04
R7423:Aox3	UTSW	1	58121069	missense	possibly damaging	0.80
R7664:Aox3	UTSW	1	58119539	missense	probably damaging	1.00
R7709:Aox3	UTSW	1	58180651	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATAAGGTGATCTAGTGAGCATGTG -3'
(R):5'- TCATTCAGCCGTGTGGAAAC -3'

Sequencing Primer
(F):5'- ATCTAGTGAGCATGTGGAACCTCC -3'
(R):5'- CTTCCCTCCTTAAAGAGTCC -3'

Posted On

2016-08-04