Incidental Mutation 'R5360:Rc3h2'
ID424268
Institutional Source Beutler Lab
Gene Symbol Rc3h2
Ensembl Gene ENSMUSG00000075376
Gene Namering finger and CCCH-type zinc finger domains 2
SynonymsMnab, D930043C02Rik, Rnf164, 2900024N03Rik, 9430019J22Rik
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37370069-37422903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37389855 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 454 (V454A)
Ref Sequence ENSEMBL: ENSMUSP00000108558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100143] [ENSMUST00000112934] [ENSMUST00000112936] [ENSMUST00000125619]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100143
AA Change: V454A

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097721
Gene: ENSMUSG00000075376
AA Change: V454A

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112934
AA Change: V454A

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108556
Gene: ENSMUSG00000075376
AA Change: V454A

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112936
AA Change: V454A

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108558
Gene: ENSMUSG00000075376
AA Change: V454A

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125619
SMART Domains Protein: ENSMUSP00000145082
Gene: ENSMUSG00000075376

DomainStartEndE-ValueType
RING 14 53 1.4e-7 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 6.9e-6 SMART
low complexity region 455 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205124
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele are viable and healthy but show increased TNF production by macrophages in response to LPS. Homozygotes for a different knock-out allele show postnatal lethality, decreased body size and weight, and an immature lung phenotype with decreased alveolar expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Rc3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Rc3h2 APN 2 37389747 missense possibly damaging 0.59
IGL00944:Rc3h2 APN 2 37398238 splice site probably benign
IGL01065:Rc3h2 APN 2 37377844 splice site probably benign
IGL01966:Rc3h2 APN 2 37382777 splice site probably benign
IGL02123:Rc3h2 APN 2 37398253 missense probably damaging 1.00
IGL02174:Rc3h2 APN 2 37411225 missense probably benign 0.11
IGL02448:Rc3h2 APN 2 37389805 missense probably benign 0.08
IGL02539:Rc3h2 APN 2 37389715 missense probably benign 0.09
IGL02698:Rc3h2 APN 2 37405300 missense probably damaging 0.99
IGL02731:Rc3h2 APN 2 37382811 missense probably benign 0.00
IGL02958:Rc3h2 APN 2 37414700 missense probably damaging 1.00
IGL02959:Rc3h2 APN 2 37405354 missense probably damaging 1.00
PIT4468001:Rc3h2 UTSW 2 37399639 missense probably damaging 1.00
R0309:Rc3h2 UTSW 2 37379008 splice site probably benign
R0488:Rc3h2 UTSW 2 37389588 missense probably damaging 0.99
R0506:Rc3h2 UTSW 2 37376659 critical splice donor site probably null
R0612:Rc3h2 UTSW 2 37411215 missense possibly damaging 0.77
R0628:Rc3h2 UTSW 2 37382052 splice site probably benign
R0647:Rc3h2 UTSW 2 37409530 missense probably damaging 1.00
R0680:Rc3h2 UTSW 2 37399835 missense probably damaging 0.97
R0738:Rc3h2 UTSW 2 37405374 missense probably damaging 1.00
R2005:Rc3h2 UTSW 2 37389753 nonsense probably null
R2105:Rc3h2 UTSW 2 37399624 missense possibly damaging 0.89
R2133:Rc3h2 UTSW 2 37378916 missense probably benign 0.12
R2373:Rc3h2 UTSW 2 37379001 missense possibly damaging 0.94
R2414:Rc3h2 UTSW 2 37399819 critical splice donor site probably null
R2850:Rc3h2 UTSW 2 37377415 missense probably benign
R2913:Rc3h2 UTSW 2 37378959 missense possibly damaging 0.89
R2932:Rc3h2 UTSW 2 37378359 missense probably benign 0.10
R4441:Rc3h2 UTSW 2 37414514 critical splice donor site probably null
R4932:Rc3h2 UTSW 2 37389832 missense possibly damaging 0.77
R5114:Rc3h2 UTSW 2 37398361 splice site probably null
R5169:Rc3h2 UTSW 2 37405312 missense probably damaging 1.00
R5477:Rc3h2 UTSW 2 37399630 missense possibly damaging 0.94
R5553:Rc3h2 UTSW 2 37398311 nonsense probably null
R5776:Rc3h2 UTSW 2 37378313 missense possibly damaging 0.59
R5842:Rc3h2 UTSW 2 37378371 missense possibly damaging 0.77
R5935:Rc3h2 UTSW 2 37414733 frame shift probably null
R6060:Rc3h2 UTSW 2 37399600 missense possibly damaging 0.77
R6112:Rc3h2 UTSW 2 37378887 missense possibly damaging 0.59
R6172:Rc3h2 UTSW 2 37414733 frame shift probably null
R6173:Rc3h2 UTSW 2 37414733 frame shift probably null
R6177:Rc3h2 UTSW 2 37389646 missense probably benign 0.02
R6455:Rc3h2 UTSW 2 37409470 missense probably damaging 1.00
R6457:Rc3h2 UTSW 2 37411139 critical splice donor site probably null
R6467:Rc3h2 UTSW 2 37382016 missense probably damaging 0.97
R6647:Rc3h2 UTSW 2 37382944 nonsense probably null
R6694:Rc3h2 UTSW 2 37400543 missense probably damaging 1.00
R6695:Rc3h2 UTSW 2 37414661 missense possibly damaging 0.88
R7054:Rc3h2 UTSW 2 37375246 missense probably benign 0.07
R7159:Rc3h2 UTSW 2 37409647 missense probably benign 0.39
R7162:Rc3h2 UTSW 2 37409605 missense possibly damaging 0.59
R7640:Rc3h2 UTSW 2 37377849 critical splice donor site probably null
R7676:Rc3h2 UTSW 2 37405332 missense possibly damaging 0.95
X0013:Rc3h2 UTSW 2 37389786 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TCAGTGCCTCGTGGGATTAG -3'
(R):5'- GAAAGCTTCAAGTGCATGTGTAC -3'

Sequencing Primer
(F):5'- GCTGAGAAACACTGCTTTCTG -3'
(R):5'- GCCTGCATTTGTATGTGACATG -3'
Posted On2016-08-04