Incidental Mutation 'R5360:Ikbkap'
ID424277
Institutional Source Beutler Lab
Gene Symbol Ikbkap
Ensembl Gene ENSMUSG00000028431
Gene Nameinhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein
SynonymsC78473, Elp1, IKAP, 3110040G09Rik
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5360 (G1)
Quality Score224
Status Not validated
Chromosome4
Chromosomal Location56749680-56802331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56800104 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 7 (H7Q)
Ref Sequence ENSEMBL: ENSMUSP00000030140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030140] [ENSMUST00000045368] [ENSMUST00000131520] [ENSMUST00000147763]
Predicted Effect probably benign
Transcript: ENSMUST00000030140
AA Change: H7Q

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030140
Gene: ENSMUSG00000028431
AA Change: H7Q

DomainStartEndE-ValueType
Pfam:IKI3 1 955 N/A PFAM
low complexity region 1186 1205 N/A INTRINSIC
low complexity region 1210 1225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045368
SMART Domains Protein: ENSMUSP00000047275
Gene: ENSMUSG00000038827

DomainStartEndE-ValueType
Pfam:GCV_H 117 185 5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131520
Predicted Effect probably benign
Transcript: ENSMUST00000147763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152638
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scaffold protein and a regulator for three different kinases involved in proinflammatory signaling. The encoded protein can bind NF-kappa-B-inducing kinase and I-kappa-B kinases through separate domains and assemble them into an active kinase complex. Mutations in this gene have been associated with familial dysautonomia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with arrested neural and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Ikbkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ikbkap APN 4 56784537 critical splice donor site probably null
IGL01521:Ikbkap APN 4 56771059 missense probably benign 0.27
IGL02069:Ikbkap APN 4 56779731 missense probably benign 0.31
IGL02162:Ikbkap APN 4 56796502 critical splice donor site probably null
IGL02252:Ikbkap APN 4 56759813 missense probably benign 0.09
IGL02726:Ikbkap APN 4 56767878 critical splice acceptor site probably null
IGL02822:Ikbkap APN 4 56774520 critical splice donor site probably null
IGL03024:Ikbkap APN 4 56774686 critical splice donor site probably null
IGL03126:Ikbkap APN 4 56779717 missense probably benign
R0211:Ikbkap UTSW 4 56795545 missense probably damaging 1.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0603:Ikbkap UTSW 4 56792105 missense possibly damaging 0.94
R1109:Ikbkap UTSW 4 56786723 missense probably benign 0.00
R1314:Ikbkap UTSW 4 56786647 missense probably benign 0.00
R1333:Ikbkap UTSW 4 56770969 splice site probably benign
R1434:Ikbkap UTSW 4 56781193 missense probably benign 0.02
R1547:Ikbkap UTSW 4 56792090 missense probably damaging 1.00
R1547:Ikbkap UTSW 4 56798810 missense probably damaging 1.00
R1587:Ikbkap UTSW 4 56786666 nonsense probably null
R1601:Ikbkap UTSW 4 56774756 nonsense probably null
R2076:Ikbkap UTSW 4 56786620 missense probably damaging 0.98
R2153:Ikbkap UTSW 4 56779636 intron probably null
R2263:Ikbkap UTSW 4 56755298 splice site probably null
R2325:Ikbkap UTSW 4 56784622 missense probably benign 0.00
R2333:Ikbkap UTSW 4 56775456 missense probably benign 0.28
R3151:Ikbkap UTSW 4 56770985 missense probably benign 0.24
R3622:Ikbkap UTSW 4 56759925 splice site probably null
R3624:Ikbkap UTSW 4 56798708 missense possibly damaging 0.52
R3889:Ikbkap UTSW 4 56759852 missense probably damaging 1.00
R4007:Ikbkap UTSW 4 56794139 missense probably damaging 1.00
R4196:Ikbkap UTSW 4 56755353 missense probably damaging 1.00
R4794:Ikbkap UTSW 4 56781176 small deletion probably benign
R5330:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5331:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5362:Ikbkap UTSW 4 56778969 missense probably damaging 0.99
R5645:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R5877:Ikbkap UTSW 4 56787807 missense probably damaging 1.00
R6268:Ikbkap UTSW 4 56762305 missense probably damaging 1.00
R6284:Ikbkap UTSW 4 56762281 missense probably damaging 0.99
R6526:Ikbkap UTSW 4 56798812 critical splice acceptor site probably null
R6610:Ikbkap UTSW 4 56758236 missense probably benign 0.02
R6627:Ikbkap UTSW 4 56784647 splice site probably null
R6786:Ikbkap UTSW 4 56771555 missense possibly damaging 0.80
R6823:Ikbkap UTSW 4 56787939 missense probably damaging 1.00
R7129:Ikbkap UTSW 4 56787944 missense probably damaging 1.00
R7157:Ikbkap UTSW 4 56781176 small deletion probably benign
R7180:Ikbkap UTSW 4 56796535 missense probably damaging 1.00
R7391:Ikbkap UTSW 4 56781211 missense possibly damaging 0.82
R7391:Ikbkap UTSW 4 56781212 missense probably benign 0.00
R7403:Ikbkap UTSW 4 56778994 missense probably damaging 1.00
R7432:Ikbkap UTSW 4 56776925 missense probably damaging 1.00
R7674:Ikbkap UTSW 4 56792075 missense probably damaging 0.97
R7736:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R7755:Ikbkap UTSW 4 56774552 missense possibly damaging 0.80
R7760:Ikbkap UTSW 4 56790892 missense probably benign 0.20
R7849:Ikbkap UTSW 4 56758968 missense possibly damaging 0.65
R7932:Ikbkap UTSW 4 56758968 missense possibly damaging 0.65
Z1176:Ikbkap UTSW 4 56790146 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTAAGGGGACTAACGTGGAG -3'
(R):5'- CGAGAGTGTAGCCGTGTATG -3'

Sequencing Primer
(F):5'- CTAACGTGGAGAAGGAGGTTTG -3'
(R):5'- GGGTGGCCATTTATCTCT -3'
Posted On2016-08-04