Incidental Mutation 'R5360:Ttc39b'
ID424278
Institutional Source Beutler Lab
Gene Symbol Ttc39b
Ensembl Gene ENSMUSG00000038172
Gene Nametetratricopeptide repeat domain 39B
Synonyms9130422G05Rik, 1810054D07Rik
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location83220300-83324255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83261847 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 103 (D103G)
Ref Sequence ENSEMBL: ENSMUSP00000124490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030205] [ENSMUST00000048274] [ENSMUST00000102823] [ENSMUST00000148811] [ENSMUST00000150522]
Predicted Effect probably damaging
Transcript: ENSMUST00000030205
AA Change: D133G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030205
Gene: ENSMUSG00000038172
AA Change: D133G

DomainStartEndE-ValueType
Pfam:DUF3808 75 173 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048274
AA Change: D133G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040590
Gene: ENSMUSG00000038172
AA Change: D133G

DomainStartEndE-ValueType
Pfam:DUF3808 75 478 2.2e-147 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102823
AA Change: D133G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099887
Gene: ENSMUSG00000038172
AA Change: D133G

DomainStartEndE-ValueType
Pfam:DUF3808 75 533 3.6e-167 PFAM
Pfam:TPR_8 329 360 4.5e-3 PFAM
Pfam:TPR_6 563 594 6.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146519
Predicted Effect probably damaging
Transcript: ENSMUST00000148811
AA Change: D103G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124490
Gene: ENSMUSG00000038172
AA Change: D103G

DomainStartEndE-ValueType
Pfam:DUF3808 45 143 9.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150522
AA Change: D103G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124955
Gene: ENSMUSG00000038172
AA Change: D103G

DomainStartEndE-ValueType
Pfam:DUF3808 45 179 1.6e-50 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Neurl2 C A 2: 164,833,101 A114S probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Ttc39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Ttc39b APN 4 83244039 splice site probably benign
IGL02118:Ttc39b APN 4 83297949 missense probably damaging 1.00
IGL02860:Ttc39b APN 4 83263746 missense probably benign 0.14
IGL03008:Ttc39b APN 4 83247695 missense probably benign 0.00
IGL03136:Ttc39b APN 4 83237280 missense probably damaging 0.97
IGL03310:Ttc39b APN 4 83247659 missense probably benign 0.00
IGL03409:Ttc39b APN 4 83260956 missense probably damaging 1.00
R0536:Ttc39b UTSW 4 83227198 missense probably damaging 1.00
R0654:Ttc39b UTSW 4 83241701 missense probably benign 0.03
R1690:Ttc39b UTSW 4 83227177 missense probably damaging 1.00
R1758:Ttc39b UTSW 4 83237349 missense probably damaging 1.00
R1933:Ttc39b UTSW 4 83232720 missense possibly damaging 0.87
R2221:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R2223:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R4182:Ttc39b UTSW 4 83237301 missense probably damaging 1.00
R4746:Ttc39b UTSW 4 83244103 missense probably benign 0.01
R4984:Ttc39b UTSW 4 83242209 missense probably benign 0.05
R5328:Ttc39b UTSW 4 83261941 missense probably damaging 1.00
R5429:Ttc39b UTSW 4 83243953 missense possibly damaging 0.50
R5646:Ttc39b UTSW 4 83244070 missense probably damaging 1.00
R6353:Ttc39b UTSW 4 83230493 missense probably benign 0.07
R6681:Ttc39b UTSW 4 83240048 intron probably benign
R6873:Ttc39b UTSW 4 83246276 missense probably damaging 1.00
R7274:Ttc39b UTSW 4 83261851 missense possibly damaging 0.95
R7414:Ttc39b UTSW 4 83242222 missense probably damaging 0.99
R7536:Ttc39b UTSW 4 83239978 nonsense probably null
X0064:Ttc39b UTSW 4 83260939 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGCATAGAACGGAACTGTCC -3'
(R):5'- ATACACGGTGAGGATTAGGTATTG -3'

Sequencing Primer
(F):5'- GGAACTGTCCAAGACACTTTAAATC -3'
(R):5'- TGAGGATTAGGTATTGTTGGTATCAG -3'
Posted On2016-08-04